ID: 1061627150

View in Genome Browser
Species Human (GRCh38)
Location 9:131847510-131847532
Sequence AGCCCTCCCCACCCACCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061627150_1061627162 30 Left 1061627150 9:131847510-131847532 CCCGGGGGTGGGTGGGGAGGGCT No data
Right 1061627162 9:131847563-131847585 CCAGTCTGTCCTATCTGTTCTGG No data
1061627150_1061627153 -7 Left 1061627150 9:131847510-131847532 CCCGGGGGTGGGTGGGGAGGGCT No data
Right 1061627153 9:131847526-131847548 GAGGGCTAGCTGAGGACCCACGG 0: 1
1: 0
2: 1
3: 11
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061627150 Original CRISPR AGCCCTCCCCACCCACCCCC GGG (reversed) Intergenic