ID: 1061627152

View in Genome Browser
Species Human (GRCh38)
Location 9:131847518-131847540
Sequence TGGGTGGGGAGGGCTAGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061627137_1061627152 22 Left 1061627137 9:131847473-131847495 CCTTGAACCAGGCAGAGGCTTCT No data
Right 1061627152 9:131847518-131847540 TGGGTGGGGAGGGCTAGCTGAGG No data
1061627138_1061627152 15 Left 1061627138 9:131847480-131847502 CCAGGCAGAGGCTTCTCTCTTCT No data
Right 1061627152 9:131847518-131847540 TGGGTGGGGAGGGCTAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061627152 Original CRISPR TGGGTGGGGAGGGCTAGCTG AGG Intergenic