ID: 1061627153

View in Genome Browser
Species Human (GRCh38)
Location 9:131847526-131847548
Sequence GAGGGCTAGCTGAGGACCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 222}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061627150_1061627153 -7 Left 1061627150 9:131847510-131847532 CCCGGGGGTGGGTGGGGAGGGCT No data
Right 1061627153 9:131847526-131847548 GAGGGCTAGCTGAGGACCCACGG 0: 1
1: 0
2: 1
3: 11
4: 222
1061627138_1061627153 23 Left 1061627138 9:131847480-131847502 CCAGGCAGAGGCTTCTCTCTTCT No data
Right 1061627153 9:131847526-131847548 GAGGGCTAGCTGAGGACCCACGG 0: 1
1: 0
2: 1
3: 11
4: 222
1061627137_1061627153 30 Left 1061627137 9:131847473-131847495 CCTTGAACCAGGCAGAGGCTTCT No data
Right 1061627153 9:131847526-131847548 GAGGGCTAGCTGAGGACCCACGG 0: 1
1: 0
2: 1
3: 11
4: 222
1061627151_1061627153 -8 Left 1061627151 9:131847511-131847533 CCGGGGGTGGGTGGGGAGGGCTA No data
Right 1061627153 9:131847526-131847548 GAGGGCTAGCTGAGGACCCACGG 0: 1
1: 0
2: 1
3: 11
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061627153 Original CRISPR GAGGGCTAGCTGAGGACCCA CGG Intergenic