ID: 1061627615

View in Genome Browser
Species Human (GRCh38)
Location 9:131850542-131850564
Sequence TGGGCACTGCCCCGTTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061627615_1061627619 30 Left 1061627615 9:131850542-131850564 CCAGGAAAACGGGGCAGTGCCCA No data
Right 1061627619 9:131850595-131850617 TTTTTTCTTTTTTTTGAGACTGG 0: 221
1: 14126
2: 18562
3: 33350
4: 64636

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061627615 Original CRISPR TGGGCACTGCCCCGTTTTCC TGG (reversed) Intergenic
No off target data available for this crispr