ID: 1061628392

View in Genome Browser
Species Human (GRCh38)
Location 9:131855991-131856013
Sequence GCAAACTCACCATTGCATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061628392_1061628394 17 Left 1061628392 9:131855991-131856013 CCTAAATGCAATGGTGAGTTTGC No data
Right 1061628394 9:131856031-131856053 TCAGCCTTTCATGCAGTCAGTGG No data
1061628392_1061628397 21 Left 1061628392 9:131855991-131856013 CCTAAATGCAATGGTGAGTTTGC No data
Right 1061628397 9:131856035-131856057 CCTTTCATGCAGTCAGTGGTGGG No data
1061628392_1061628395 20 Left 1061628392 9:131855991-131856013 CCTAAATGCAATGGTGAGTTTGC No data
Right 1061628395 9:131856034-131856056 GCCTTTCATGCAGTCAGTGGTGG No data
1061628392_1061628398 27 Left 1061628392 9:131855991-131856013 CCTAAATGCAATGGTGAGTTTGC No data
Right 1061628398 9:131856041-131856063 ATGCAGTCAGTGGTGGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061628392 Original CRISPR GCAAACTCACCATTGCATTT AGG (reversed) Intergenic
No off target data available for this crispr