ID: 1061628397

View in Genome Browser
Species Human (GRCh38)
Location 9:131856035-131856057
Sequence CCTTTCATGCAGTCAGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061628391_1061628397 22 Left 1061628391 9:131855990-131856012 CCCTAAATGCAATGGTGAGTTTG No data
Right 1061628397 9:131856035-131856057 CCTTTCATGCAGTCAGTGGTGGG No data
1061628392_1061628397 21 Left 1061628392 9:131855991-131856013 CCTAAATGCAATGGTGAGTTTGC No data
Right 1061628397 9:131856035-131856057 CCTTTCATGCAGTCAGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061628397 Original CRISPR CCTTTCATGCAGTCAGTGGT GGG Intergenic
No off target data available for this crispr