ID: 1061628476

View in Genome Browser
Species Human (GRCh38)
Location 9:131856417-131856439
Sequence TCTGGGGCTCCTCAGCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061628476_1061628482 -2 Left 1061628476 9:131856417-131856439 CCTTGCTGCTGAGGAGCCCCAGA No data
Right 1061628482 9:131856438-131856460 GAGCTCGGCCGTGGCCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061628476 Original CRISPR TCTGGGGCTCCTCAGCAGCA AGG (reversed) Intergenic
No off target data available for this crispr