ID: 1061634656

View in Genome Browser
Species Human (GRCh38)
Location 9:131899690-131899712
Sequence TCTCGATGGCAGAGCCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061634656 Original CRISPR TCTCGATGGCAGAGCCAGGA GGG (reversed) Intronic
900343806 1:2201314-2201336 GCTCGAAGGCACAGCCTGGAAGG + Intronic
901232282 1:7647839-7647861 TCTGGGTGGCCGAGGCAGGAGGG + Intronic
901848601 1:12000668-12000690 CCAGGATGTCAGAGCCAGGAGGG + Intronic
902571935 1:17352574-17352596 TCTGGAAGGCAGAGCCAGCAGGG + Intronic
902578212 1:17391889-17391911 TGCCCATGGCAGAGCCAGGTTGG - Intronic
902773229 1:18658293-18658315 CCTCGAAGACACAGCCAGGATGG - Intronic
903888510 1:26554987-26555009 TCTGGTTGGCAGAGGCAAGAGGG + Intronic
903972016 1:27125083-27125105 TCTAGAAGGCAGAACCAGCAGGG - Intronic
904796186 1:33058146-33058168 TGTGGATGGCAGAGAAAGGATGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
906783406 1:48592706-48592728 TCTCGATGTCAGAGCTAGAGAGG + Intronic
908710064 1:67005178-67005200 TCTCAGTGGAAGAGCCAGGGAGG - Intronic
911693750 1:100864066-100864088 TCTAAATGGCAGAGCCTGGATGG - Intergenic
913549378 1:119902763-119902785 CCACAATGGCAGAGCCATGAAGG + Intergenic
914323747 1:146590839-146590861 TATTGATGTCAGAGCCAGGAAGG + Intergenic
915631537 1:157156498-157156520 TCCAGATGCCAGAGCCAGAAGGG - Intergenic
917643153 1:177003152-177003174 CCTTGATGCCAAAGCCAGGAAGG + Intronic
918945290 1:191056961-191056983 TCTCTATGGGAGAGCAAAGAAGG + Intergenic
921226962 1:213030183-213030205 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
921712463 1:218386645-218386667 TCTGGATGGCAGAGAAAGGGAGG + Intronic
922517903 1:226222427-226222449 TCTAGAATGCAGAGACAGGACGG + Intergenic
1063922497 10:10946143-10946165 TTTTAATGACAGAGCCAGGATGG - Intergenic
1065695592 10:28376764-28376786 TTTCCAGGGCAGAGCCTGGAAGG - Intergenic
1068276021 10:54797973-54797995 TATGGATGGCAGGGGCAGGATGG - Intronic
1070071788 10:73096905-73096927 CCGCGATGGCAGCGCCAGGGAGG + Exonic
1072744468 10:97930084-97930106 TCTCTGTAGCAGTGCCAGGAAGG + Intronic
1073440939 10:103552333-103552355 GCTCCATTGCCGAGCCAGGATGG - Intronic
1074412593 10:113241368-113241390 TCTGGAAGACAGAGCCCGGAGGG + Intergenic
1076125516 10:127971015-127971037 TATCTGTGGCAGACCCAGGAAGG + Intronic
1076316674 10:129546712-129546734 TCTCCATGGCAGAGCACAGAGGG + Intronic
1077647828 11:3941925-3941947 TTTCGGAGGCAGAGGCAGGAGGG - Intronic
1078268286 11:9771311-9771333 TCTAAATGGCAGGGGCAGGATGG - Intergenic
1078557330 11:12340051-12340073 TCTGGAAGGTAGAGCCAAGATGG - Intronic
1079158039 11:17967199-17967221 TTTCAATGGCAAAGCTAGGATGG + Intronic
1079851549 11:25541977-25541999 TCTCGATGGCACAGCAGAGATGG + Intergenic
1081260276 11:40951136-40951158 TCTGGAGGGCAAAGACAGGAAGG + Intronic
1082986423 11:59173732-59173754 TTTCCAGGTCAGAGCCAGGAAGG + Intronic
1083882535 11:65555595-65555617 TCTGGAAGGCAGGGCCAGGCTGG + Intronic
1084191548 11:67501636-67501658 TCTGAATGTCAGAGCCAGTATGG + Intronic
1087153966 11:94883211-94883233 CCCCAGTGGCAGAGCCAGGAGGG + Intergenic
1089329549 11:117680132-117680154 CCTGGATGGCAGAGCTAGGCTGG - Intronic
1094495247 12:30985162-30985184 TGTAGATGGCAGAACCAAGATGG - Intronic
1096155875 12:49341378-49341400 CCGTGATGGCAGAGGCAGGAGGG - Intergenic
1097687878 12:62708138-62708160 TCTCTCTGTAAGAGCCAGGAAGG - Intronic
1099338292 12:81393787-81393809 TCAAGATGACTGAGCCAGGAAGG - Intronic
1101280001 12:103243804-103243826 TGTCCATGGCAGTGCCAGCAAGG + Intronic
1102027545 12:109722109-109722131 TCTGACGGGCAGAGCCAGGAAGG + Intronic
1102237796 12:111305165-111305187 GCTCTCTGGGAGAGCCAGGATGG - Intronic
1104614965 12:130259808-130259830 TCTGGATGGCGGTGCCTGGAGGG - Intergenic
1108140511 13:47416108-47416130 CCTGGAGGACAGAGCCAGGAGGG + Intergenic
1110803307 13:79725735-79725757 TCTAGATGGAAGAATCAGGATGG - Intergenic
1111879094 13:93932690-93932712 TCACGGTCCCAGAGCCAGGAAGG - Intronic
1113947281 13:114051322-114051344 TGACGCTGGGAGAGCCAGGAAGG - Intronic
1114034966 14:18615408-18615430 TCTCAAAGGCAGTGACAGGAAGG + Intergenic
1114123680 14:19699608-19699630 TCTCAAAGGCAGTGACAGGAAGG - Intergenic
1114704028 14:24707442-24707464 TCCTGATGGCTGAGGCAGGACGG + Intergenic
1116813599 14:49563305-49563327 TTTGGATGGCAGAGGCAGGAGGG + Intergenic
1122284808 14:100644483-100644505 TCCCAGTGGCAGAGACAGGAAGG + Intergenic
1123151045 14:106182124-106182146 TCCTGATGACAGAGCCATGAAGG + Intergenic
1123161139 14:106278887-106278909 TCCTGATGACAGAGCCATGAGGG + Intergenic
1123399461 15:19970008-19970030 TCCTGATGACAGAGCCATGAGGG + Intergenic
1123480338 15:20625273-20625295 TCCGGATGACAGAGCCATGAGGG + Intergenic
1123637670 15:22375092-22375114 TCCTGATGACAGAGCCATGAGGG - Intergenic
1126429066 15:48561222-48561244 TCCAAAGGGCAGAGCCAGGAAGG - Intronic
1126665227 15:51069858-51069880 TTTCGAAGGCAGATGCAGGAAGG - Intronic
1127836846 15:62797201-62797223 TCTCCCTGAGAGAGCCAGGAGGG - Exonic
1128202850 15:65824351-65824373 ACTCCATGGAAGAGCCAGGGAGG + Intronic
1128544093 15:68555795-68555817 TCCAGGTGGCAGAGCCAGGGAGG + Intergenic
1129693973 15:77730118-77730140 ACTAGATGCCAGAGCCAAGAGGG - Intronic
1129794482 15:78365804-78365826 GGTCAGTGGCAGAGCCAGGAGGG - Intergenic
1130099773 15:80884286-80884308 TCTGGATGACATGGCCAGGAAGG + Exonic
1131383182 15:91981220-91981242 CCTGGCTGGCAGAGCAAGGAGGG - Intronic
1132662298 16:1066865-1066887 TCTCGAGGACAGCACCAGGAGGG - Intergenic
1132848212 16:2010504-2010526 TCTGGATGGCAGAGGGAGGGAGG - Intronic
1132996911 16:2828177-2828199 GCTGGATGGCAGAGTCAGGAAGG - Intergenic
1133042663 16:3068785-3068807 CCTCCATGGCAGTGACAGGATGG - Intronic
1134746219 16:16590936-16590958 CCTAGAGGGCAGAGCTAGGATGG + Intergenic
1134999262 16:18762764-18762786 CCTAGAGGGCAGAGCTAGGATGG - Intergenic
1136286531 16:29247381-29247403 TCTCTAGGGGAGAACCAGGAAGG - Intergenic
1137065554 16:35838438-35838460 TCTGAAAGGCAGAGGCAGGATGG + Intergenic
1139317758 16:66087753-66087775 GGTCAATGGCAGAGTCAGGAAGG - Intergenic
1140009817 16:71120006-71120028 TATTGATGTCAGAGCCAGGAAGG - Intronic
1140133663 16:72186037-72186059 TCTCCAGGACAGAGCTAGGAGGG + Intergenic
1141426744 16:83949273-83949295 TCTGGAGGGGAGACCCAGGAAGG - Exonic
1141859989 16:86709992-86710014 TGTCAAGGGCAGAGCCAGGTGGG + Intergenic
1141939861 16:87268137-87268159 TCATGATGGCAGAGAAAGGAAGG - Intronic
1142092119 16:88219955-88219977 TCTCTAGGGGAGAACCAGGAAGG - Intergenic
1144967790 17:19089012-19089034 TCCCTATGGCAGGGCCAGGGCGG - Intergenic
1144980126 17:19163051-19163073 TCCCTATGGCAGGGCCAGGGCGG + Intergenic
1144988096 17:19215181-19215203 TCCCTATGGCAGGGCCAGGGCGG - Intergenic
1147166038 17:38593937-38593959 TCTGGCTGGTAAAGCCAGGACGG + Intronic
1147606664 17:41777504-41777526 TCTGGCTGGCAGCTCCAGGACGG + Intronic
1148748592 17:49931878-49931900 TCGGCTTGGCAGAGCCAGGAGGG - Intergenic
1149521178 17:57319336-57319358 TTTCGGTGGCATGGCCAGGACGG + Intronic
1150255565 17:63741676-63741698 AATCGGTGGCAGAGCCAGGAGGG + Intronic
1151320312 17:73348846-73348868 CCTGGAAGGCAGACCCAGGAAGG - Intronic
1151494197 17:74449762-74449784 CCAAGATGGCAGGGCCAGGAAGG - Intronic
1151828041 17:76534667-76534689 AGTAGATGGCAGTGCCAGGAAGG + Intronic
1152040401 17:77899179-77899201 TGTAGATGGCAGGGGCAGGATGG + Intergenic
1152434859 17:80270215-80270237 GCTGGGTGGCAGAGCCAGGGAGG - Intronic
1152551211 17:81031249-81031271 TGTCTGGGGCAGAGCCAGGAGGG - Intergenic
1152653375 17:81507285-81507307 CCTGGATGACAGAGCCAGGATGG + Intergenic
1152925054 17:83083387-83083409 CCTCGATGCCAGAGACGGGAGGG + Intronic
1155891616 18:31277499-31277521 TCTCGATGGCAGCACCAAAAGGG - Intergenic
1157718855 18:49907989-49908011 GCTCCATGGCTCAGCCAGGAGGG + Intronic
1160261913 18:77301995-77302017 TCGCGATGGCAGGGCCAGTAAGG - Intergenic
1162113630 19:8414898-8414920 CATCGGTGGCATAGCCAGGAGGG + Intronic
1163302579 19:16457322-16457344 GCTAGATGGAAGAGACAGGATGG + Intronic
1168134520 19:54341513-54341535 TCTCCATGGCAGAGGCTGGAGGG + Intergenic
1168455875 19:56507949-56507971 GCTCGAGGGCTGGGCCAGGAAGG + Intronic
924991096 2:314033-314055 TGTCCATGGCAGAACCAGGAGGG + Intergenic
925463150 2:4082533-4082555 ACCAGATGGAAGAGCCAGGAGGG + Intergenic
927698617 2:25253282-25253304 CCTCGAGGGCAGAGCCAACAGGG - Intronic
928396968 2:30949977-30949999 TCTAGATGGCAGAATCAGAATGG - Intronic
929136950 2:38633918-38633940 ACTCGATGGGAGAGGAAGGAAGG - Intergenic
930078575 2:47428150-47428172 TCACCATGTTAGAGCCAGGAAGG - Intronic
932047652 2:68365618-68365640 TCCAGATGGCAGGGCCTGGAAGG + Intronic
933949842 2:87319478-87319500 TGTTGATGGCAGAGGAAGGAGGG + Intergenic
933991182 2:87634897-87634919 TCTGGCTGGTAGAGGCAGGAGGG + Intergenic
936058546 2:109279772-109279794 CCTCGCTGACAGAGCCAGGCCGG + Intronic
936302657 2:111315926-111315948 TCTGGCTGGTAGAGGCAGGAGGG - Intergenic
936330351 2:111542119-111542141 TGTTGATGGCAGAGGAAGGAGGG - Intergenic
938128098 2:128688937-128688959 TCTCCCTGCCAGAGCCAGGAGGG + Intergenic
938276281 2:130027439-130027461 TCTCAAAGGCAGTGACAGGAAGG - Intergenic
938439095 2:131309917-131309939 TCTCAAAGGCAGTGACAGGAAGG + Intronic
940909446 2:159197063-159197085 TCTAGAGGGCAGAGCAGGGAAGG - Intronic
941707090 2:168670696-168670718 TATTGATAGCATAGCCAGGAAGG - Intronic
943785653 2:191875645-191875667 GCTGAGTGGCAGAGCCAGGATGG - Intergenic
946193097 2:218017826-218017848 TGCAGCTGGCAGAGCCAGGAGGG - Intergenic
946974284 2:225131166-225131188 TCTGGATGACAGAGCTAGGTTGG + Intergenic
947799823 2:232921825-232921847 GCTCCTTGGGAGAGCCAGGACGG + Intronic
1171168554 20:22994752-22994774 TCACCATGGGAGAGGCAGGATGG - Intergenic
1171462980 20:25309292-25309314 TCCCCATGGCAGAGGCAGGAGGG - Intronic
1172175668 20:32970583-32970605 TCTGAATGGCGGAGCCAGGATGG - Intergenic
1173433990 20:43016289-43016311 GCCTGATGGCAGAGCAAGGAAGG - Intronic
1173864463 20:46305484-46305506 TCCCCATAGCTGAGCCAGGAAGG - Intronic
1174298096 20:49562877-49562899 ACTAGATGGAAGAGCCATGAAGG + Intronic
1174368033 20:50068201-50068223 TTTGGATGGCACAGCCAGGTAGG + Intergenic
1175198906 20:57265271-57265293 CCGCGATGCCAGAGCCAGGCAGG + Intronic
1175854406 20:62112674-62112696 TCTCCATGGCAGAGGCAGAAAGG + Intergenic
1175967149 20:62665455-62665477 TCTCGGTGCCAGAGGCAGGCTGG + Intronic
1179486892 21:41716216-41716238 AGTCAATGGCAGAGGCAGGAAGG + Intergenic
1180219707 21:46350769-46350791 TCTCGGAGGGAGAGCCTGGAAGG - Intronic
1180459086 22:15542456-15542478 TCTCAAAGGCAGTGACAGGAAGG + Intergenic
1181481029 22:23199250-23199272 TCTCTGTGCAAGAGCCAGGAAGG + Intronic
1182074365 22:27484949-27484971 CCTGGATGGCAGAGCAAGGCTGG - Intergenic
1182642543 22:31780095-31780117 TCTCTATACCAGAGCCAGAAGGG - Intronic
950201645 3:11048588-11048610 TTTCTAAGGCAGAGCCAGGAGGG + Intergenic
951599295 3:24355661-24355683 TCTCTCTGGTATAGCCAGGAAGG - Intronic
952328672 3:32343660-32343682 TCTCAATGGCAGTGCAACGATGG - Intronic
952382268 3:32814935-32814957 TCTCTATGGCAAGGCCAGTATGG + Intergenic
953236855 3:41114432-41114454 TTTGGAAGGCAGAGACAGGAAGG + Intergenic
953531078 3:43740385-43740407 TCCCCTTGCCAGAGCCAGGATGG - Intergenic
954726293 3:52613745-52613767 TTTAGAAGGCAGAGGCAGGAGGG + Intronic
957037890 3:75311920-75311942 TCTTCGTGGCAGAGCCAGAAAGG + Intergenic
957401356 3:79719057-79719079 ACTCAATGGCAGATCCAGAATGG + Intronic
960145049 3:114192003-114192025 GCTCAATGGCAGAGAGAGGAGGG + Intronic
961085883 3:124067149-124067171 TCTTCATGGCAGAGCCAGAAAGG + Intergenic
964681537 3:159345472-159345494 TCCCCAAGGCAGAGCCAGGAAGG + Intronic
966855830 3:184193343-184193365 GCTGGAAGGCAGAACCAGGAAGG - Exonic
968933699 4:3597984-3598006 TCTCCCTTGCAGACCCAGGAGGG - Intergenic
968993865 4:3933137-3933159 TCTGGATGAGTGAGCCAGGAAGG - Intergenic
969817056 4:9694690-9694712 GCTCTATGGAAGAGGCAGGAAGG - Intergenic
976332320 4:83846676-83846698 TCTCCATGGCATAGACAAGATGG + Intergenic
984956301 4:185049421-185049443 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
985102854 4:186475420-186475442 TCTCGCAGGCAGACCCTGGAGGG + Intronic
992145166 5:73839644-73839666 TCTGAATGGCAGAGAAAGGACGG - Intronic
995066346 5:107867545-107867567 TCAGGATGGCAGGCCCAGGAGGG + Intronic
997408713 5:133673399-133673421 CCAGGATAGCAGAGCCAGGAGGG - Intergenic
998349883 5:141493657-141493679 TCTCCATGGCAGCCCCAGAATGG + Intronic
999305684 5:150518044-150518066 TGTCCTGGGCAGAGCCAGGAAGG - Intronic
999314511 5:150575269-150575291 CCTCCATGGCAGGGCCAGGATGG - Intergenic
999328464 5:150657560-150657582 TCCAGACAGCAGAGCCAGGAGGG - Intronic
1000362488 5:160460978-160461000 TCTCGTGGGCTGAGGCAGGAGGG - Intergenic
1002791075 6:438144-438166 CAACGGTGGCAGAGCCAGGACGG + Intergenic
1004184845 6:13413055-13413077 ACTCAGTGGCAGAGCCAAGAGGG - Intronic
1004743365 6:18485467-18485489 TGTCGGTGGCAAAGCCATGATGG + Intergenic
1012500288 6:99880962-99880984 TTTCAATGGCTGGGCCAGGATGG + Intergenic
1012584421 6:100904957-100904979 GCTTGGTGGTAGAGCCAGGAGGG - Intergenic
1014033459 6:116737541-116737563 TCACGATTGCAGGGCAAGGAAGG - Intronic
1018206190 6:161439291-161439313 TCAAGAGGGCAGAGCCGGGAAGG + Intronic
1019137765 6:169922035-169922057 TCTTGGTGGCAGAGCGAGGCTGG + Intergenic
1022509789 7:30927775-30927797 TCTCAAGGGGAGGGCCAGGAGGG - Intergenic
1023856774 7:44188929-44188951 GCTGGACGACAGAGCCAGGATGG - Intronic
1026583819 7:71639570-71639592 TCTCCATGGCAGAGGTAGCAGGG - Intronic
1026941905 7:74291884-74291906 TCAGGGTGGCAGGGCCAGGAGGG - Intronic
1028485016 7:91348156-91348178 TCTCAAAGGCAGAGGCAGGCTGG + Intergenic
1029353096 7:100029545-100029567 TCCCAGTGGCAGAGCCAGGATGG - Intronic
1030186999 7:106773415-106773437 TGTCAGTGGCAGAGCCAGGCTGG - Intergenic
1030527119 7:110667645-110667667 TCTCGAAGCCAGAGAAAGGAAGG + Intronic
1031135546 7:117880004-117880026 TCTTGAGGGAAGAGCTAGGATGG - Intergenic
1031669510 7:124525583-124525605 CCTCTATGGCAGGGCCATGAAGG + Intergenic
1037821919 8:22139230-22139252 GCTCAGTGCCAGAGCCAGGAAGG + Intronic
1040799883 8:51328815-51328837 TCCCGCTGCCAGGGCCAGGAGGG - Intronic
1042824662 8:72967893-72967915 TTTGGAAGGCAAAGCCAGGAGGG + Intergenic
1046130998 8:109968670-109968692 TGTGGGTGGCAGAGCAAGGAGGG - Intronic
1047127529 8:121978944-121978966 TCTGAATGACAGACCCAGGATGG + Intergenic
1047735410 8:127760912-127760934 CCTCCAGGGCAGAGCCAGGATGG - Intergenic
1048966701 8:139620114-139620136 TGACAATGTCAGAGCCAGGATGG + Intronic
1049241153 8:141537974-141537996 TCACCATGGCAGATCCAAGAAGG + Intergenic
1049250960 8:141588780-141588802 TCCAGCTGGCAGATCCAGGAAGG - Intergenic
1049289698 8:141795269-141795291 TCACGATAGAAGAGACAGGAGGG - Intergenic
1049309017 8:141923580-141923602 TTTCCCTGGCAGGGCCAGGAGGG + Intergenic
1051454903 9:17244458-17244480 TTTGGAAGGCAGAGGCAGGAGGG - Intronic
1054456445 9:65433832-65433854 TCTCCCTTGCAGACCCAGGATGG + Intergenic
1054949543 9:70834769-70834791 TCTTGAGGTCACAGCCAGGATGG - Intronic
1056930079 9:90867000-90867022 TCTCATTGGCAGGGACAGGAGGG + Intronic
1057441731 9:95088552-95088574 TCACTGAGGCAGAGCCAGGAAGG + Intergenic
1061634656 9:131899690-131899712 TCTCGATGGCAGAGCCAGGAGGG - Intronic
1061977023 9:134074060-134074082 TGTGGATGGCAAAGCCAAGATGG - Intergenic
1062194861 9:135267286-135267308 ACCCGGTGGCAGAGCCAGGGAGG - Intergenic
1062327494 9:136019237-136019259 TGTTCATGGCAGAGACAGGACGG + Intronic
1190402670 X:50054428-50054450 TCCCCTTGTCAGAGCCAGGAGGG + Intronic
1194446367 X:93992009-93992031 TGGAGATGGCAGAACCAGGAGGG - Intergenic
1198867776 X:141143674-141143696 TCTTGATGGCAGAACCATGTTGG - Intergenic
1200831658 Y:7692043-7692065 TCTCAGTGGCAGAGCTACGAAGG + Intergenic
1200979528 Y:9248884-9248906 TCTCAATGGGAGAGCTGGGAAGG - Intergenic
1202115256 Y:21465642-21465664 TCTCAGTGGCAGAGCTGGGAAGG - Intergenic