ID: 1061638142

View in Genome Browser
Species Human (GRCh38)
Location 9:131928557-131928579
Sequence AGGGAGAGCACAGCGACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061638131_1061638142 22 Left 1061638131 9:131928512-131928534 CCAGCAGCTGCTAAATGGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 258
Right 1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG No data
1061638128_1061638142 29 Left 1061638128 9:131928505-131928527 CCTTCCTCCAGCAGCTGCTAAAT 0: 1
1: 0
2: 0
3: 27
4: 293
Right 1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG No data
1061638130_1061638142 25 Left 1061638130 9:131928509-131928531 CCTCCAGCAGCTGCTAAATGGCC 0: 1
1: 0
2: 0
3: 16
4: 223
Right 1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG No data
1061638134_1061638142 4 Left 1061638134 9:131928530-131928552 CCTGGAGAGGATCTGCACACTTG 0: 1
1: 0
2: 3
3: 7
4: 179
Right 1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061638142 Original CRISPR AGGGAGAGCACAGCGACTGG GGG Intronic
No off target data available for this crispr