ID: 1061639488 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:131940874-131940896 |
| Sequence | TAAGAGATACAGGTTTCATC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1061639488_1061639491 | -2 | Left | 1061639488 | 9:131940874-131940896 | CCAGATGAAACCTGTATCTCTTA | No data | ||
| Right | 1061639491 | 9:131940895-131940917 | TAAGGTTTTCAGTGACATTAAGG | No data | ||||
| 1061639488_1061639493 | 28 | Left | 1061639488 | 9:131940874-131940896 | CCAGATGAAACCTGTATCTCTTA | No data | ||
| Right | 1061639493 | 9:131940925-131940947 | ATGAGAACTGGCACATATAAAGG | No data | ||||
| 1061639488_1061639492 | 16 | Left | 1061639488 | 9:131940874-131940896 | CCAGATGAAACCTGTATCTCTTA | No data | ||
| Right | 1061639492 | 9:131940913-131940935 | TAAGGACTTAGCATGAGAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1061639488 | Original CRISPR | TAAGAGATACAGGTTTCATC TGG (reversed) | Intronic | ||