ID: 1061639488

View in Genome Browser
Species Human (GRCh38)
Location 9:131940874-131940896
Sequence TAAGAGATACAGGTTTCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061639488_1061639491 -2 Left 1061639488 9:131940874-131940896 CCAGATGAAACCTGTATCTCTTA No data
Right 1061639491 9:131940895-131940917 TAAGGTTTTCAGTGACATTAAGG No data
1061639488_1061639493 28 Left 1061639488 9:131940874-131940896 CCAGATGAAACCTGTATCTCTTA No data
Right 1061639493 9:131940925-131940947 ATGAGAACTGGCACATATAAAGG No data
1061639488_1061639492 16 Left 1061639488 9:131940874-131940896 CCAGATGAAACCTGTATCTCTTA No data
Right 1061639492 9:131940913-131940935 TAAGGACTTAGCATGAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061639488 Original CRISPR TAAGAGATACAGGTTTCATC TGG (reversed) Intronic