ID: 1061639554

View in Genome Browser
Species Human (GRCh38)
Location 9:131941546-131941568
Sequence CTGTTGTCGTTGTTTACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061639554_1061639558 28 Left 1061639554 9:131941546-131941568 CCAGTGGTAAACAACGACAACAG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1061639558 9:131941597-131941619 AAGGCGTGGAGGTGCACTGAAGG No data
1061639554_1061639555 9 Left 1061639554 9:131941546-131941568 CCAGTGGTAAACAACGACAACAG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1061639555 9:131941578-131941600 TGCAGCAGAGATGAGTGAGAAGG No data
1061639554_1061639556 14 Left 1061639554 9:131941546-131941568 CCAGTGGTAAACAACGACAACAG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1061639556 9:131941583-131941605 CAGAGATGAGTGAGAAGGCGTGG No data
1061639554_1061639557 17 Left 1061639554 9:131941546-131941568 CCAGTGGTAAACAACGACAACAG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1061639557 9:131941586-131941608 AGATGAGTGAGAAGGCGTGGAGG No data
1061639554_1061639559 29 Left 1061639554 9:131941546-131941568 CCAGTGGTAAACAACGACAACAG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1061639559 9:131941598-131941620 AGGCGTGGAGGTGCACTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061639554 Original CRISPR CTGTTGTCGTTGTTTACCAC TGG (reversed) Intronic
902281909 1:15381007-15381029 CTGTTGTCATTTTTCACCCCCGG + Intronic
905636160 1:39554290-39554312 CTCTTGTCATTGATTACCAAAGG - Intergenic
907632665 1:56098833-56098855 CTGTTATCATTTTTCACCACAGG - Intergenic
909118353 1:71568573-71568595 TTTTTGTTGTTATTTACCACTGG - Intronic
912711826 1:111955406-111955428 CTGTTGTTGTTGTTTGAGACAGG - Intronic
914216610 1:145636297-145636319 CTGTTTTTGTTGTTTACAAGTGG + Intronic
914469179 1:147958979-147959001 CTGTTTTTGTTGTTTACAAGTGG + Intronic
917875242 1:179280707-179280729 TTGTTGTCGTTGTTGAAAACTGG + Intergenic
922111786 1:222565858-222565880 CTGTTGTTGTTGTTTGAAACAGG - Intronic
924282794 1:242454937-242454959 CTGTTCTTCTTTTTTACCACAGG + Intronic
1063724181 10:8618969-8618991 CTGTTGTGGTTTTTTCACACTGG + Intergenic
1064744860 10:18468446-18468468 CTGTTGTTGTTGTTTGAGACAGG - Intronic
1065038719 10:21668054-21668076 TTGTTGTTGTTGTTTTCTACTGG - Intronic
1067561762 10:47309547-47309569 TTGTTGTTGTTGTTTGCTACGGG + Intronic
1068746554 10:60538223-60538245 CTGTTATCCTTGTTCACCACTGG - Intronic
1070971364 10:80570064-80570086 ATGTGATGGTTGTTTACCACTGG + Intronic
1071878655 10:89870355-89870377 TTGTTTACCTTGTTTACCACAGG + Intergenic
1074359694 10:112815396-112815418 CTGTTGTTGCTGTTTATCAAGGG - Exonic
1075838691 10:125478406-125478428 CTGGTGACATTGTTTACCTCTGG - Intergenic
1077277659 11:1722143-1722165 CTTTTTTCGTTCTTTACAACAGG - Intergenic
1080019912 11:27549781-27549803 TGGTTGTGGTTCTTTACCACAGG + Intergenic
1085698505 11:78726160-78726182 CTGTTGTTCTTTTTTCCCACAGG + Exonic
1089928335 11:122282471-122282493 CTGTTGTCGTGGTCTTCAACAGG + Intergenic
1092546146 12:9452819-9452841 TTGTTGTTGTTGTTTCCCAGGGG - Intergenic
1094506803 12:31069245-31069267 TTGTTGTTGTTGTTTCCCAGGGG + Intergenic
1095437061 12:42201595-42201617 CTGTTGTTGTTGTTGAGCCCAGG + Intronic
1096986914 12:55765724-55765746 TTGTTGTTGTTGTTTTCCCCTGG - Intronic
1098101899 12:67026926-67026948 TTGTTGTTGTTGTTTAAAACTGG + Intergenic
1098395164 12:70009876-70009898 CTGTTTTTGTTGTATCCCACAGG - Intergenic
1098570779 12:71985344-71985366 TTGTTGTTGTTGTTTTCCAATGG + Intronic
1098913117 12:76230678-76230700 CTGTTGTTGTTGTTTGAGACAGG + Intergenic
1101464946 12:104939108-104939130 CCTTTGTCATAGTTTACCACTGG + Intronic
1103077293 12:117994350-117994372 TTGTTGTTGTTGTTTGACACAGG - Intergenic
1106490938 13:30221265-30221287 ATTTTGTAGTTGTTTACCATAGG - Intronic
1110237086 13:73228178-73228200 CTGTTGTCCTTGTTGGCCATTGG + Intergenic
1113948250 13:114056992-114057014 CTGTTGTCCTTGGGAACCACGGG + Intronic
1114955121 14:27807781-27807803 TTATTGTTGTTGTTTAACACAGG + Intergenic
1120750563 14:88193789-88193811 CTGTTTCCGTTGTTAAGCACTGG - Intronic
1120817269 14:88874883-88874905 ATGTTGTCGGTATTTATCACAGG + Intronic
1135085952 16:19474663-19474685 CTTTTGTTGTTGTTTAAGACAGG - Intronic
1140131938 16:72170437-72170459 CTGTTGTTGTTGTTTGAGACAGG + Intronic
1145322980 17:21777367-21777389 CTGTTCTGGGTGATTACCACTGG + Intergenic
1155495337 18:26436832-26436854 CTGCTGTGGTTGTTTCCCACTGG + Intergenic
1156248113 18:35322853-35322875 CTGTTGTCGTTGCCTAACATTGG - Intergenic
1156390552 18:36646767-36646789 TTGTTGTTGTTGTTTACACCAGG - Intronic
1162685409 19:12379041-12379063 TTGTTGTTGTTGTTCAACACTGG - Intergenic
1164853932 19:31505953-31505975 TTGTTGTTGTTGTTTGACACAGG + Intergenic
1165343508 19:35228585-35228607 CTGTTGGCACTGCTTACCACTGG + Exonic
1166023037 19:40050375-40050397 TTGTTGTTGTTGTTTTCCAGGGG - Exonic
1166025945 19:40084796-40084818 TTGTTGTTGTTGTTTTCCAGGGG - Exonic
1166624934 19:44343151-44343173 CTGTTGTCATTCTTTACCCTTGG + Intronic
927367108 2:22310108-22310130 ATGTTGTTATTGTTTGCCACTGG - Intergenic
928807487 2:35177491-35177513 CTGTTGTCTTTGTTTGACATTGG + Intergenic
934969486 2:98751298-98751320 CTGTTGTCATTGTTTATTGCAGG + Intergenic
942567216 2:177279123-177279145 CTCTTATTGTTGTTTCCCACTGG + Intronic
947479433 2:230484880-230484902 CTGGTGTCTTTTTTTCCCACTGG + Intronic
948621744 2:239239663-239239685 TTGTTCTCGTTGTGTGCCACTGG + Intronic
1179129007 21:38617799-38617821 CTGTTGTCTTTGTTTCCCAAAGG + Intronic
1180052572 21:45338311-45338333 GAGTTGTCTTTGTGTACCACTGG + Intergenic
1183138601 22:35914773-35914795 CTTTTGCTGTTGTTTACCCCCGG - Intronic
1184138466 22:42563207-42563229 TTGTTGTTGTTGTTTTCAACAGG + Intronic
953244363 3:41177282-41177304 CTGTTGTCGTTTCTTCCAACTGG + Intergenic
955628823 3:60950334-60950356 CTGTTATCTTTGTATACCATTGG + Intronic
963012007 3:140778931-140778953 CTGTTGTTGTTGTTTAAAATAGG - Intergenic
965273963 3:166656618-166656640 CTGTTGTTGCTGTATCCCACAGG - Intergenic
967978693 3:195051501-195051523 TTGCTGACGTTGTTTACCAGTGG + Intergenic
974861471 4:67527110-67527132 CTGTTGTAGCTGTATTCCACAGG - Intronic
974927106 4:68312899-68312921 ATGTTATAGTTGGTTACCACTGG + Exonic
984393056 4:179163439-179163461 CTGTTGTCAGTGTTTACCCCTGG + Intergenic
984513310 4:180706459-180706481 CTGTTGTTGTTGTTTGGGACAGG - Intergenic
985698100 5:1353381-1353403 CTGTTGTCTTTGTTTATCCCTGG + Intergenic
988990999 5:36670957-36670979 CTGTTCCCATTGTTTTCCACTGG + Intronic
993218665 5:85061142-85061164 CTTTTGTCTTTGTTTTCCTCTGG + Intergenic
993567981 5:89498977-89498999 CTGCTGTCGTTATTAAACACAGG + Intergenic
998022978 5:138787058-138787080 CTGTTGACGTTGTTTAGGATGGG + Intronic
998658538 5:144208801-144208823 CTGATTTCGTTTTTTTCCACAGG - Intronic
1000551531 5:162671503-162671525 CAGTTGTCGTTGTTTTCCAACGG - Intergenic
1003933480 6:10951741-10951763 CCTTTATCATTGTTTACCACAGG + Intronic
1005116230 6:22340490-22340512 CTTTTGTGGTTGATTACCAGCGG - Intergenic
1007552480 6:42740717-42740739 TTGTTGTTGTTTTTTACAACAGG - Intergenic
1011879172 6:92002000-92002022 CTGTTGCTGTTGTTTAACACGGG + Intergenic
1013046010 6:106486118-106486140 CTGCTTTCGTTGTGTCCCACAGG + Intergenic
1016191272 6:141267903-141267925 CTTTTTTTCTTGTTTACCACTGG - Intergenic
1020021181 7:4870132-4870154 CTGTTGTTGTTGTTTGAGACAGG - Intronic
1027394757 7:77742830-77742852 TTGTTGTTGTTGTTTAAGACAGG - Intronic
1027766054 7:82343649-82343671 TTGTTGTCGTTGTTTAATTCTGG + Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1036218763 8:6902875-6902897 CTGTTGTCCGTCTTTTCCACTGG - Intergenic
1037922094 8:22814655-22814677 CTGTGGTCATTGTGAACCACAGG + Intronic
1051841821 9:21406387-21406409 CTGTTGTCCTTTTTTACAAAAGG - Intergenic
1053425908 9:38009772-38009794 CTGTTTTCCTTGCTTACAACTGG - Intronic
1055171248 9:73260768-73260790 CTGTTGTCTTTGTTCATCTCTGG + Intergenic
1057852230 9:98574640-98574662 CTGTGTTAGTTATTTACCACTGG - Intronic
1061639554 9:131941546-131941568 CTGTTGTCGTTGTTTACCACTGG - Intronic
1062293686 9:135811742-135811764 CTGCTGTAATTGTTTACAACAGG - Intronic
1203779016 EBV:90448-90470 CTGTTGTCCTTGGTTAGCCCCGG + Intergenic
1188772047 X:34164128-34164150 CTGTTGTAGTTGTATCTCACTGG - Intergenic
1188797687 X:34485179-34485201 CTGTTGTAGTTGTATCTCACGGG - Intergenic
1190529483 X:51361013-51361035 TTGTTGTTGTTGTTTTCCATGGG - Intergenic
1191758540 X:64622376-64622398 CTGTTCTCTTTTTTTCCCACAGG - Intergenic
1194007238 X:88510095-88510117 TTGTTGTTGTTGTTTAGAACAGG + Intergenic
1197257739 X:124282032-124282054 TTGTTGTTGTTGTTTAGCAAAGG - Intronic
1201852745 Y:18505313-18505335 CTGCTTTGGTTGTTTCCCACAGG + Intergenic
1201880576 Y:18815071-18815093 CTGCTTTGGTTGTTTCCCACAGG - Intronic