ID: 1061640361

View in Genome Browser
Species Human (GRCh38)
Location 9:131949527-131949549
Sequence TGTAAGAAAGCCCTAGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061640361_1061640367 16 Left 1061640361 9:131949527-131949549 CCCCATTCTAGGGCTTTCTTACA 0: 1
1: 0
2: 1
3: 10
4: 168
Right 1061640367 9:131949566-131949588 TTAGGTCTGCGAGGATTCCTTGG No data
1061640361_1061640366 7 Left 1061640361 9:131949527-131949549 CCCCATTCTAGGGCTTTCTTACA 0: 1
1: 0
2: 1
3: 10
4: 168
Right 1061640366 9:131949557-131949579 GTGCTTTTATTAGGTCTGCGAGG No data
1061640361_1061640368 26 Left 1061640361 9:131949527-131949549 CCCCATTCTAGGGCTTTCTTACA 0: 1
1: 0
2: 1
3: 10
4: 168
Right 1061640368 9:131949576-131949598 GAGGATTCCTTGGAAAAAGCAGG No data
1061640361_1061640364 -2 Left 1061640361 9:131949527-131949549 CCCCATTCTAGGGCTTTCTTACA 0: 1
1: 0
2: 1
3: 10
4: 168
Right 1061640364 9:131949548-131949570 CACACCGCAGTGCTTTTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061640361 Original CRISPR TGTAAGAAAGCCCTAGAATG GGG (reversed) Intronic
905048675 1:35029829-35029851 TGGAAGAAAAGCCTAAAATGGGG - Intronic
905609013 1:39332286-39332308 TGGAAGAAAGCAATAGAAAGTGG + Intronic
906656886 1:47554602-47554624 TCTAAGAAGGCCCTGGAATCAGG - Intergenic
907849281 1:58238815-58238837 TATAAGAAAGCACAAAAATGGGG - Intronic
912453336 1:109781114-109781136 TGTAACAAATACCTAAAATGTGG - Intergenic
918090315 1:181287467-181287489 TGCAAACAAGCCCTAGAATAAGG - Intergenic
919413409 1:197275658-197275680 TGTAAAATAGCACTAGAATTAGG + Intronic
919575306 1:199301408-199301430 TGTATTAAAGCCATAGATTGAGG - Intergenic
923994785 1:239481404-239481426 TTGAAAAAAGCCCTAGTATGTGG - Intronic
1064360570 10:14660758-14660780 AGAAAGAAAGTTCTAGAATGAGG - Intronic
1065735197 10:28745178-28745200 AGTATGAAAGCCCTAAATTGGGG + Intergenic
1067279031 10:44857510-44857532 TGTAAGAAAGCCCTTGGGTCTGG + Intergenic
1067527893 10:47049352-47049374 TTTAAGGAAGCCCTAGCATGGGG - Intergenic
1069743381 10:70699752-70699774 TTTAACCAAGCCCCAGAATGGGG + Intronic
1069846803 10:71377619-71377641 GGCAAGAAAGCCCTAGAGAGAGG + Intergenic
1070077488 10:73152170-73152192 TGTAAGAATGCAGTAAAATGTGG - Intronic
1071813102 10:89204977-89204999 TGGCAGAATGCCCCAGAATGTGG - Intergenic
1074692804 10:116021792-116021814 TGGAAGAAAGGTCCAGAATGAGG - Intergenic
1075590098 10:123684942-123684964 TGGCAGAAAGCCCTACAGTGAGG - Intronic
1076573728 10:131450027-131450049 TTAAAAAAAGCCATAGAATGAGG + Intergenic
1077652444 11:3985471-3985493 TGAAAGAAAGCCCATAAATGAGG + Intronic
1078954975 11:16183102-16183124 TTCTAGAAAGCCCTAGAATAAGG - Intronic
1086827692 11:91519438-91519460 TTTAAGAAAGCCCTGGCAGGGGG + Intergenic
1092361849 12:7843360-7843382 TGGATGAAAGCCTGAGAATGCGG + Intronic
1092378064 12:7972046-7972068 TGGATGAAAGCCTGAGAATGCGG + Intergenic
1094117614 12:26934395-26934417 TGTAGGGAAAGCCTAGAATGGGG + Intronic
1096331076 12:50713261-50713283 TGTAAGTTAGCACCAGAATGTGG + Intronic
1101476964 12:105060133-105060155 AGTAAGACAGATCTAGAATGAGG - Intronic
1106211977 13:27657575-27657597 TATCAGAATGCCCTAGAGTGAGG - Intronic
1106821816 13:33473235-33473257 TCTATGAAGGCCCTATAATGGGG + Intergenic
1107183000 13:37484114-37484136 TTTGAGAAAGCACAAGAATGAGG + Intergenic
1107313735 13:39108415-39108437 TGAAAGAAAGCCCTACAAATAGG - Intergenic
1109678526 13:65714184-65714206 TTTAAGAAAGGACTATAATGAGG + Intergenic
1109728873 13:66383654-66383676 TGTAAGAAATTCCCAGAAAGTGG - Intronic
1109900462 13:68762625-68762647 TGAAATAAAGCCCTTGACTGTGG - Intergenic
1112036885 13:95505375-95505397 TGTAAGACATCCCTGGAATGTGG - Intronic
1112530676 13:100199525-100199547 TGTAGGAAACACCAAGAATGGGG - Intronic
1116185902 14:41600656-41600678 TGTAAGAAAGTCCAACCATGTGG + Intergenic
1116771608 14:49132481-49132503 TGTCAGAAATACCTAGAGTGAGG - Intergenic
1117063525 14:51986378-51986400 TGTAAGGAAAGCCTAGAAGGAGG - Intergenic
1120176439 14:81298330-81298352 TGGATGACAGCCCTAGGATGTGG - Intronic
1122505455 14:102229054-102229076 TGAAAGAAAACCCTAGAATGCGG + Exonic
1123767020 15:23491302-23491324 TGTAAGAAGGCAAGAGAATGTGG - Intergenic
1126445098 15:48733556-48733578 TATATGAAAGCCCCAGAAAGAGG + Intronic
1126870758 15:52984329-52984351 TGTAAGACAAACCTAGAGTGGGG + Intergenic
1127181828 15:56428412-56428434 TTTATGAAAGCACTTGAATGGGG + Exonic
1130837781 15:87668600-87668622 GGTAAATAAGTCCTAGAATGAGG - Intergenic
1133814021 16:9182836-9182858 TGGAAGCAAGCTCTAGAAAGAGG + Intergenic
1134774253 16:16838197-16838219 TGAAAGAAAGCCCAAGTCTGAGG - Intergenic
1138603897 16:58074903-58074925 TGTAACAAATACCTAAAATGAGG + Intergenic
1138730255 16:59186212-59186234 TGTAACAAATACCTAAAATGTGG - Intergenic
1139973229 16:70789447-70789469 TGCAAGGAGGCCCAAGAATGGGG + Intronic
1146601274 17:34218870-34218892 TGTAAGAAATCTCAAGGATGGGG + Intergenic
1146962849 17:36999677-36999699 TGAAAGCAAGCCCTAGGATAGGG + Intronic
1148697868 17:49571918-49571940 TGAAAGAAAGCCTGGGAATGGGG - Intergenic
1149170183 17:53800271-53800293 TGTAAGAAAGCCCTCAAAGCTGG - Intergenic
1154120747 18:11650448-11650470 TGTAACAAAAACCTAAAATGTGG + Intergenic
1155884794 18:31194894-31194916 TGTAAGAAAGGCAAATAATGTGG + Intergenic
1155959051 18:31978368-31978390 GGTAAGAAATCTCTAGGATGAGG - Intergenic
1156332270 18:36133608-36133630 TGTAAGCAGGGCCTAGACTGAGG + Intronic
1156639081 18:39068266-39068288 GGTAAGAAAGACATAGGATGTGG + Intergenic
1158022783 18:52863184-52863206 TATAAGAAAGCATGAGAATGTGG - Intronic
1158330201 18:56353877-56353899 TGAAATAAAGCCTGAGAATGTGG - Intergenic
1159868992 18:73739580-73739602 TTTAAGAAAGTCCTTAAATGAGG + Intergenic
1161551790 19:4917019-4917041 TGAAAGAGAGCCCCTGAATGTGG + Intronic
1162219365 19:9163131-9163153 TCTGAGAAAGCTCTTGAATGGGG + Exonic
1163890898 19:20012063-20012085 TGTAACAAAACCTTGGAATGTGG + Intronic
1165061872 19:33208739-33208761 TTTAAGGAAGCCCTAAAATGTGG - Exonic
1166024903 19:40073590-40073612 TGTGAGAAAGTCTTTGAATGAGG - Exonic
927943684 2:27121850-27121872 TGTAAGAAAGCACTACAAACTGG - Intergenic
927971582 2:27308823-27308845 TGTCAGACAGCCCTACAATTTGG - Intergenic
929834425 2:45381798-45381820 TGTACGAAAACTCTAGAAGGTGG + Intergenic
930280293 2:49361800-49361822 AGTAAGAACACCCTAGAATAAGG + Intergenic
930473133 2:51845947-51845969 TGAATAAAAGCCTTAGAATGGGG + Intergenic
931012799 2:57937001-57937023 TGGAAGAAAGAACTAGAATCTGG - Intronic
932245321 2:70191771-70191793 TGTTGGAAAACCCTGGAATGAGG + Intronic
936591654 2:113810034-113810056 TTTTGGAAAGCCCTAGAATGAGG - Intergenic
940375466 2:152953429-152953451 TGCAAGAAAGCCCCAGAAATTGG + Intergenic
942738223 2:179140773-179140795 TGTTAGAAAGCACAAGATTGAGG - Intronic
946184282 2:217969938-217969960 TGTAATCAAGCTCTAAAATGGGG + Intronic
946712328 2:222518947-222518969 TGAAAGAAAGCACAAGAATGTGG + Intronic
947138242 2:226996138-226996160 TGTAAGAAAGACCTAAGGTGGGG + Exonic
948313793 2:237011199-237011221 TGTAAGAAAGCATGAGAATAGGG - Intergenic
948398093 2:237662251-237662273 TATAAGAAAGTCATTGAATGAGG + Intronic
1173136587 20:40444085-40444107 CATAAGAAAGACCCAGAATGGGG - Intergenic
1175206511 20:57315889-57315911 TCTCAGAACCCCCTAGAATGAGG + Intergenic
949197557 3:1331188-1331210 AGAAAGAATGCCCTAGAAAGGGG - Intronic
950280253 3:11701134-11701156 TGGAAGCAAGGCCTAGTATGAGG + Intronic
951065662 3:18262245-18262267 TGTAGTATAGCCATAGAATGGGG + Intronic
951177891 3:19623144-19623166 TTTAAGCCAGCCTTAGAATGAGG - Intergenic
951764327 3:26180252-26180274 TGTAAGAAAGCAGAAAAATGTGG - Intergenic
951849617 3:27124570-27124592 TGTAAGACAGCCCTAGCTTCTGG - Intronic
952220850 3:31322840-31322862 TGTAAAAAATCCCTATAATTAGG - Intergenic
952490497 3:33867221-33867243 TTTTAGAAAGTCCTATAATGTGG + Exonic
952982817 3:38752079-38752101 TGTAAAAAAGGAGTAGAATGGGG + Intronic
953767955 3:45758687-45758709 TCCAGGAAAGCCCTAGAATTAGG - Exonic
954251722 3:49372927-49372949 TATCAGGAAGCCCTACAATGAGG + Intronic
954906177 3:54064941-54064963 TGCAAGAAAGGCCTAGAAAAGGG + Intergenic
956134701 3:66087295-66087317 TGTAAAGAAGCCTTAGAAGGGGG + Intergenic
957613823 3:82503795-82503817 TGTAAGAAAGAACTACCATGAGG + Intergenic
959840501 3:110969163-110969185 GGTAAGACATCCCTAGTATGTGG - Intergenic
960364471 3:116754075-116754097 TGTATGACAGCCTTAGAATGAGG + Intronic
964747307 3:160024455-160024477 TGAAAGAAGGCTCTACAATGGGG - Intronic
965793356 3:172412079-172412101 TATATGAAATGCCTAGAATGAGG + Intergenic
966512728 3:180782003-180782025 TGAAAGGAAGGCCTTGAATGTGG - Intronic
967231319 3:187339879-187339901 AGTAAGAAAGCCCTATTGTGTGG - Intergenic
970918631 4:21366731-21366753 AGTTAGAAAGCAGTAGAATGAGG + Intronic
971593277 4:28496616-28496638 TGTAAGAATGCCCAAAAATGTGG + Intergenic
971757941 4:30724334-30724356 TGTCAGACAGCCCAAGCATGGGG + Exonic
972306071 4:37831275-37831297 TGGAGGAAAGACTTAGAATGGGG + Intronic
973863546 4:55089400-55089422 TGAAAGAAGGAACTAGAATGAGG - Exonic
973893874 4:55393683-55393705 TGTGAGAAAGCCCTGGAGTGTGG + Intergenic
974693964 4:65340492-65340514 TGTGTGAAACCCCAAGAATGAGG + Intronic
975045497 4:69798412-69798434 TGTAATAAATACCTAAAATGTGG + Intergenic
976354935 4:84106117-84106139 TGTAATAAGGTCCTAGAATCTGG + Intergenic
976365858 4:84231342-84231364 TGTAAGAATACCCAAAAATGTGG - Intergenic
977395379 4:96464441-96464463 TTTAAGAAAACCCTAGAAGCAGG + Intergenic
980950213 4:139368078-139368100 TGTAACAAAAACCTAAAATGTGG - Intronic
986795890 5:11211479-11211501 TGTAAAACAGACCTAGAATTTGG - Intronic
987157585 5:15106121-15106143 TGAAACAAAGACCTAGAAGGTGG + Intergenic
989722395 5:44544868-44544890 TATATGAAACCCCTAGAAAGTGG - Intergenic
991253704 5:64592259-64592281 TGACAGAAAGCCCTAAACTGAGG + Intronic
991618584 5:68521441-68521463 TGTAAGAATTCCCAAGAACGTGG - Intergenic
992331623 5:75722824-75722846 TGTTAAAGATCCCTAGAATGAGG - Intergenic
993469392 5:88288416-88288438 TGTAATAAGGCCTGAGAATGTGG + Intergenic
995250835 5:109991742-109991764 TGTAACAAAGTCCTACAATCTGG + Intergenic
997735890 5:136212454-136212476 TGGAGGAAAGTTCTAGAATGGGG + Intergenic
997899228 5:137749069-137749091 TGTAAGACAGTTCTATAATGTGG - Intergenic
1002275936 5:178104543-178104565 TGTAAGACAGCTCTAGGAGGAGG + Intergenic
1003607724 6:7579772-7579794 GGTAAGAAACCACTATAATGAGG + Exonic
1005468402 6:26137993-26138015 TGTAAGGAAGGCCAAGAAGGTGG + Intronic
1007284587 6:40738357-40738379 CGTCAGAAAGCCCTAGTCTGAGG - Intergenic
1007295737 6:40819293-40819315 TCTCAGAAAGCACTAGAATGTGG - Intergenic
1008306072 6:49901589-49901611 TGTAAGAAAGTCAAAGAAAGGGG - Intergenic
1009614233 6:65984604-65984626 AGTTAGGAAGCCCTAAAATGGGG - Intergenic
1012048341 6:94307485-94307507 TGTAAGATGTCCCTAGCATGTGG - Intergenic
1014426101 6:121308442-121308464 TGTAGGAACGGCCTAGAATAGGG - Intronic
1014550154 6:122780807-122780829 CTAAAGAAAGCCTTAGAATGAGG - Intronic
1015135079 6:129859630-129859652 GGGAAGAAAGCCCAAGTATGAGG - Intronic
1016084259 6:139893660-139893682 TGGAAGAAAGGCCTGGAAAGAGG + Intergenic
1016743244 6:147550705-147550727 TGTACAATAGACCTAGAATGTGG + Intronic
1018387243 6:163316048-163316070 TGTAAGATAGCCCCAGATCGTGG + Intergenic
1021567094 7:22026674-22026696 TGTAACAAAGCCCTATGGTGTGG - Intergenic
1021580533 7:22148213-22148235 TCTAAGAAAGACCCAGAGTGAGG + Intronic
1021737607 7:23654841-23654863 GGTAAGAAATCCCTAATATGAGG + Intergenic
1026031387 7:66797653-66797675 TGTAAGAAAGACGAGGAATGTGG + Intronic
1027235093 7:76293285-76293307 CTTAAGAGAGCCCTAGAAAGTGG - Intergenic
1027817523 7:82995453-82995475 TGTAAGAAAGTGCTGGATTGTGG + Intronic
1028124844 7:87100893-87100915 TGTGACAAAGCCCTAGAAATGGG - Intergenic
1031102649 7:117501270-117501292 TGTTTGAAAGGCTTAGAATGAGG - Intronic
1032990534 7:137390043-137390065 TAAAAGAAAGACCTAAAATGGGG + Intronic
1036732579 8:11279020-11279042 CATAAGAAAGACCTGGAATGAGG + Intergenic
1041562999 8:59241750-59241772 TGAAAGTTAGCCCTAGAATCTGG + Intergenic
1041594269 8:59628684-59628706 TGTAAGATGGCCCAAGATTGAGG - Intergenic
1045182103 8:99795459-99795481 TGTAACAAAAGCCTAAAATGTGG - Intronic
1053603304 9:39632064-39632086 TGTAACAATGCCCTAGAACTGGG + Intergenic
1054250234 9:62710361-62710383 TGTAACAATGCCCTAGAACTGGG - Intergenic
1054564342 9:66744889-66744911 TGTAACAATGCCCTAGAACTGGG - Intergenic
1055468159 9:76585722-76585744 TGTAACAAATACCTAAAATGTGG - Intergenic
1055599231 9:77898002-77898024 TGTAAGAAGGGCCAAGAAAGCGG + Intronic
1057762874 9:97890674-97890696 TGAAAGAAAGCCCCAGCATGAGG + Intergenic
1058258145 9:102795431-102795453 TAAAAGAAAGCCCTAGGATAGGG - Intergenic
1058263965 9:102874308-102874330 TTTAAGAAAACCATAGAATTAGG - Intergenic
1059391799 9:114004005-114004027 TGTAACAAACCCATAGAACGGGG - Intronic
1061640361 9:131949527-131949549 TGTAAGAAAGCCCTAGAATGGGG - Intronic
1185824056 X:3232177-3232199 AGTGAGAAAGCCCCAGAAAGGGG + Intergenic
1190338174 X:49275553-49275575 GGAAAGAATGCCCTAGAATAAGG - Intronic
1192249923 X:69403524-69403546 TGTTACAATGCCCTTGAATGGGG - Intergenic
1192343787 X:70284662-70284684 TGTAAGAAATCCATCAAATGAGG - Exonic
1192350619 X:70353315-70353337 TGTAAGAACCCCTTGGAATGAGG + Intronic
1194376218 X:93136902-93136924 TGTAACAAATACCTAAAATGTGG + Intergenic
1196273395 X:113738310-113738332 CGTATGAAAGCCCTGGAGTGGGG + Intergenic
1196861466 X:120032856-120032878 TGTACTAAAGACCTAAAATGTGG + Intergenic
1196973591 X:121135493-121135515 TGTATAAAAGCAGTAGAATGTGG - Intergenic
1197581783 X:128293386-128293408 TGTAAGAATACCCAAAAATGTGG + Intergenic
1200703326 Y:6420703-6420725 GGTAAGAAAGCCCTCAAATCTGG + Intergenic
1201030784 Y:9744004-9744026 GGTAAGAAAGCCCTCAAATCTGG - Intergenic
1202148486 Y:21823987-21824009 GGTATGAAAGCCCTCAAATGGGG - Intergenic
1202178026 Y:22115493-22115515 GGTAAGAAAGCCCTCAAATCAGG + Intergenic
1202213335 Y:22470902-22470924 GGTAAGAAAGCCCTCAAATCAGG - Intergenic