ID: 1061640362

View in Genome Browser
Species Human (GRCh38)
Location 9:131949528-131949550
Sequence GTGTAAGAAAGCCCTAGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061640362_1061640368 25 Left 1061640362 9:131949528-131949550 CCCATTCTAGGGCTTTCTTACAC 0: 1
1: 0
2: 1
3: 13
4: 139
Right 1061640368 9:131949576-131949598 GAGGATTCCTTGGAAAAAGCAGG No data
1061640362_1061640366 6 Left 1061640362 9:131949528-131949550 CCCATTCTAGGGCTTTCTTACAC 0: 1
1: 0
2: 1
3: 13
4: 139
Right 1061640366 9:131949557-131949579 GTGCTTTTATTAGGTCTGCGAGG No data
1061640362_1061640364 -3 Left 1061640362 9:131949528-131949550 CCCATTCTAGGGCTTTCTTACAC 0: 1
1: 0
2: 1
3: 13
4: 139
Right 1061640364 9:131949548-131949570 CACACCGCAGTGCTTTTATTAGG No data
1061640362_1061640367 15 Left 1061640362 9:131949528-131949550 CCCATTCTAGGGCTTTCTTACAC 0: 1
1: 0
2: 1
3: 13
4: 139
Right 1061640367 9:131949566-131949588 TTAGGTCTGCGAGGATTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061640362 Original CRISPR GTGTAAGAAAGCCCTAGAAT GGG (reversed) Intronic
907752425 1:57275000-57275022 ATGTAAGCAAGGTCTAGAATAGG + Intronic
907849282 1:58238816-58238838 GTATAAGAAAGCACAAAAATGGG - Intronic
910072311 1:83231948-83231970 GAGTGAGAAAGTCCTAGATTTGG - Intergenic
912199929 1:107445190-107445212 GTGAAAGGAAGCCTTAGATTTGG + Intronic
918184128 1:182112197-182112219 GTGTAAGAAAACCCTAGATTTGG - Intergenic
920547166 1:206827806-206827828 GTGTAATGAAGCCCTGGAGTGGG + Intronic
1064913542 10:20430076-20430098 TTGTAAGAAATGCCCAGAATAGG - Intergenic
1067527894 10:47049353-47049375 CTTTAAGGAAGCCCTAGCATGGG - Intergenic
1068527094 10:58142824-58142846 ATCTAAGAAAGACCTAGAAAGGG - Intergenic
1070841975 10:79493660-79493682 GTGTATGAAACACCTAGAACAGG - Intergenic
1071102705 10:82057924-82057946 GAGTAAGCAAGCACTAGAATGGG - Intronic
1073250343 10:102117390-102117412 GAGTTAGAAGGCCTTAGAATTGG + Intronic
1073896987 10:108173034-108173056 GAAAAAGAAAGCCATAGAATGGG - Intergenic
1075615710 10:123889793-123889815 GTGGAAGAGAGCCCCAGACTGGG - Intronic
1075976749 10:126702712-126702734 CTGGAAGTAATCCCTAGAATGGG - Intergenic
1078140420 11:8688473-8688495 GTTCAAGAAAGCACTGGAATCGG - Exonic
1080506934 11:32923967-32923989 ATTTAAAAAAGCCCTAGAAAAGG + Intronic
1081735435 11:45400211-45400233 GGGAAAGAAGGCCCTGGAATTGG + Intergenic
1084871081 11:72098931-72098953 GTGTCAGATAGCCCTGGAGTTGG - Intronic
1088977213 11:114826467-114826489 GTGTTGGAAAGCCCTGGACTTGG - Intergenic
1091681575 12:2531327-2531349 GTGGAAAGAAGCCCTAGAAAGGG + Intronic
1093317963 12:17675180-17675202 GTCTAAGAAAGCCCTCCAAGTGG - Intergenic
1094117613 12:26934394-26934416 GTGTAGGGAAAGCCTAGAATGGG + Intronic
1096630981 12:52926548-52926570 GTGTAACAAAGCCCTATTCTTGG - Intronic
1096936406 12:55284289-55284311 GTGCAAGAAATCTGTAGAATAGG - Intergenic
1098633655 12:72755060-72755082 GTGTAAGATAGCCTTAGAGCAGG - Intergenic
1102523715 12:113495630-113495652 GTGTATGAAATACCTTGAATAGG - Intergenic
1104790621 12:131479788-131479810 GTGGCAGAAATCTCTAGAATTGG - Intergenic
1107703210 13:43070796-43070818 GTGAAAGAAAGCCCTTGGAAGGG + Intronic
1108306477 13:49140389-49140411 GAGTAAGAAAGTCTTTGAATTGG - Intronic
1108883290 13:55147873-55147895 ATGTAGGAAAGGCCTAGAAAAGG - Intergenic
1114452282 14:22835259-22835281 GTGTAGGAAAGCCCTACATAAGG + Intergenic
1116688388 14:48072806-48072828 TTGTAAGAAAGCACGAGAGTGGG + Intergenic
1117475338 14:56088765-56088787 GTGTGAGAAAGCCCCTGATTTGG - Intergenic
1119853565 14:77883227-77883249 GGGAAAGAAAGCCTTAGAAAAGG + Intronic
1121465402 14:94112401-94112423 GTGGAAAAAAGCAATAGAATGGG - Intronic
1123914545 15:25009335-25009357 TTGTAAGAAATACCTACAATAGG - Intergenic
1126870757 15:52984328-52984350 GTGTAAGACAAACCTAGAGTGGG + Intergenic
1130123203 15:81070044-81070066 ATATAAGAAAGCCCTAGGACTGG + Intronic
1131630306 15:94169402-94169424 TTGTAATAAAGGCATAGAATAGG + Intergenic
1131997839 15:98148795-98148817 ATGTAAGAAAGCCAGAGAATTGG - Intergenic
1138926417 16:61596970-61596992 ATGTAAGAGAGCCCTAGAGTTGG + Intergenic
1140506735 16:75478336-75478358 GGGGAAGAAAGCCCTTGAGTAGG + Exonic
1140781567 16:78301701-78301723 GTCTAAGAAAGACTGAGAATTGG + Intronic
1144214295 17:13041541-13041563 GTATAAGATAGCTTTAGAATAGG + Intergenic
1146650441 17:34603040-34603062 GTGTAAGACAGGCCTAGGCTGGG - Intronic
1146668673 17:34721903-34721925 TTGGAACAAAGCCCTAGAAAGGG + Intergenic
1146962848 17:36999676-36999698 GTGAAAGCAAGCCCTAGGATAGG + Intronic
1151772027 17:76169926-76169948 GTGTAAGGAATGCCTATAATAGG - Intronic
1155169230 18:23254927-23254949 GTGTATGGAAGCCCTGGAATTGG + Intronic
1155952298 18:31926768-31926790 GTATCAGAAAGCCCAATAATTGG + Intronic
1156193802 18:34750327-34750349 GTGTAACAATGTCCTAAAATAGG + Intronic
1158069707 18:53456404-53456426 TTCTAAAATAGCCCTAGAATAGG - Intronic
927018260 2:18990896-18990918 GTGTAAGAAAACTCAAAAATGGG - Intergenic
927705316 2:25293163-25293185 GTGAAAGGAAGCCCTAGCAATGG - Intronic
928858017 2:35823517-35823539 ATGTGAGAAAGACCTAGAAAGGG - Intergenic
929461701 2:42106646-42106668 GTGGAAGAAAGCCCCGGGATAGG - Intergenic
930473132 2:51845946-51845968 GTGAATAAAAGCCTTAGAATGGG + Intergenic
937360390 2:121225408-121225430 GTGAAAGCTAGCCCTAGAAATGG - Intronic
939069348 2:137520102-137520124 GTGTAAAAAAGCTCTGGACTTGG + Intronic
940776797 2:157893342-157893364 GTGTCAGAAAGTGCTAGAACCGG - Intronic
947138241 2:226996137-226996159 GTGTAAGAAAGACCTAAGGTGGG + Exonic
948313794 2:237011200-237011222 CTGTAAGAAAGCATGAGAATAGG - Intergenic
1174492530 20:50911084-50911106 TTGTAAGAAAGCACATGAATAGG - Intronic
1174890911 20:54391361-54391383 CTGACAGAAAGTCCTAGAATAGG - Intergenic
1177343478 21:19836552-19836574 GTGTAAGTGAGCCATAGTATGGG + Intergenic
1182173898 22:28263072-28263094 TTTTAAGAAAGCCCTAAAATTGG + Intronic
1182950808 22:34373925-34373947 GTGAAAGAAAGCCCTCCAAGAGG - Intergenic
949280640 3:2342853-2342875 GTATAAGAAATACCTAGAATAGG + Intronic
952569072 3:34692521-34692543 GTATAAGATATCACTAGAATGGG - Intergenic
954906176 3:54064940-54064962 ATGCAAGAAAGGCCTAGAAAAGG + Intergenic
956134700 3:66087294-66087316 GTGTAAAGAAGCCTTAGAAGGGG + Intergenic
958760962 3:98307972-98307994 GTGTTGGAAAGCCGAAGAATAGG - Intergenic
962435482 3:135362653-135362675 GTGTAAGAAATGACTAGAAAGGG - Intergenic
963453267 3:145512064-145512086 GTGTAAGGAAGATCAAGAATAGG - Intergenic
963835709 3:150056129-150056151 CTGTAACAAAGCCCCAGCATTGG - Intergenic
964139757 3:153384319-153384341 GAGTAGGAAAGCTTTAGAATGGG + Intergenic
967218644 3:187230841-187230863 GAGTAAGAAAAGCCCAGAATTGG - Intronic
971413943 4:26405346-26405368 GTGTAAGACATCTCAAGAATTGG + Intronic
971561636 4:28085239-28085261 GTGTAAGAATGGACTAAAATTGG - Intergenic
972459302 4:39285680-39285702 GTGTAAGAAAGACTTTGAAGAGG - Exonic
974638511 4:64597761-64597783 GTGTAAGAAATCCGTGGATTTGG + Intergenic
975495370 4:75030681-75030703 ATGTTATAAAGCCCTGGAATGGG - Intronic
979715565 4:123833057-123833079 GTGTAAGAAAGCCCTTTCTTTGG + Intergenic
980522227 4:133949416-133949438 GTGAAAGAAAGCCCGAGTATTGG - Intergenic
980793185 4:137646535-137646557 GGGGAAGAAAACCCTAGAAAGGG + Intergenic
986498150 5:8368010-8368032 GTGGAAGAAATCCACAGAATTGG + Intergenic
987533857 5:19159427-19159449 GTGGAAGAATGTTCTAGAATAGG + Intergenic
988016232 5:25563471-25563493 GTGTAAGAAGCCCCAAGACTTGG - Intergenic
993342059 5:86737087-86737109 GCGTAAGAAAGCCCTACACCTGG - Intergenic
993876015 5:93307867-93307889 GTAGAAGAAACTCCTAGAATTGG - Intergenic
994238308 5:97391524-97391546 GGGTGAGCAAGCCCTAAAATTGG - Intergenic
996327856 5:122296016-122296038 ATGTAAGAAAGACCTAGAGTAGG - Intergenic
1000702087 5:164465061-164465083 GGATAAGAAAGCACTAGAGTTGG - Intergenic
1001626518 5:173140349-173140371 GTGTTAGAAAGCCCTAGGGGAGG + Intergenic
1002143235 5:177157821-177157843 TTGTATGAAACGCCTAGAATAGG - Intronic
1002957976 6:1887333-1887355 GTGTTAGAAGGCCATAGATTTGG + Intronic
1003500169 6:6696613-6696635 GTCTAACCAAGCCCTAGGATTGG - Intergenic
1010740804 6:79501529-79501551 GTGTTAGAAAGCTTTACAATTGG - Intronic
1012211876 6:96529637-96529659 GTGAAAGAAAGAGCTAGAAAAGG - Intronic
1013825393 6:114205064-114205086 GTGTTAGAAAACTGTAGAATTGG - Intronic
1014426102 6:121308443-121308465 CTGTAGGAACGGCCTAGAATAGG - Intronic
1015771081 6:136769279-136769301 TTCTAAGAAATACCTAGAATAGG + Intronic
1021597495 7:22332811-22332833 GTGTAAGAAAGCCAGAGAGAAGG - Intronic
1022107751 7:27209081-27209103 GTGTAACAAAGCCAAAGAACAGG + Intergenic
1023355439 7:39362749-39362771 GTGAAAGAAAGTGCTAGAGTAGG + Intronic
1024236080 7:47400198-47400220 GTGTCAGTAAGCCCCAGAAGTGG - Intronic
1026877855 7:73890015-73890037 GGGCAAGCAAGTCCTAGAATTGG - Intergenic
1027290027 7:76696916-76696938 GAGTGAGAAAGCCCTAGATTTGG - Intergenic
1028124845 7:87100894-87100916 GTGTGACAAAGCCCTAGAAATGG - Intergenic
1030302343 7:107987226-107987248 TTGTATGAAATACCTAGAATTGG + Intronic
1033228477 7:139579047-139579069 GCGTAAGGAAGCCCTAGGAGAGG + Intronic
1036605530 8:10302610-10302632 CTGGCAAAAAGCCCTAGAATGGG - Intronic
1038624868 8:29181611-29181633 GTATAAGTAGGCCCCAGAATGGG + Intronic
1041633183 8:60111393-60111415 GAGTGAGAAAAACCTAGAATGGG + Intergenic
1044852206 8:96440213-96440235 GTGTGAGAAAGGCTGAGAATGGG - Intergenic
1046820008 8:118623601-118623623 GTGAAAGAAAGCCATAGGACAGG + Intergenic
1048678605 8:136813159-136813181 TTGGAAGAAGGCCCGAGAATGGG + Intergenic
1049910414 9:260568-260590 GTGGAATAAAGTCCTAGAATTGG - Intronic
1053603303 9:39632063-39632085 TTGTAACAATGCCCTAGAACTGG + Intergenic
1053860938 9:42385782-42385804 CTGTAACAAGGCCCTAGAACTGG + Intergenic
1054250235 9:62710362-62710384 TTGTAACAATGCCCTAGAACTGG - Intergenic
1054564343 9:66744890-66744912 TTGTAACAATGCCCTAGAACTGG - Intergenic
1058258146 9:102795432-102795454 TTAAAAGAAAGCCCTAGGATAGG - Intergenic
1058564979 9:106273430-106273452 GGGTAGGATAGCTCTAGAATTGG + Intergenic
1058891892 9:109368382-109368404 TTGTAAGAAATGCCCAGAATAGG - Intergenic
1059391800 9:114004006-114004028 GTGTAACAAACCCATAGAACGGG - Intronic
1060236264 9:121865204-121865226 GTGTTAGAATGTTCTAGAATAGG - Intronic
1061640362 9:131949528-131949550 GTGTAAGAAAGCCCTAGAATGGG - Intronic
1061806820 9:133141455-133141477 GTGTAAGAAAGCCCTGCCCTTGG - Intronic
1185824055 X:3232176-3232198 GAGTGAGAAAGCCCCAGAAAGGG + Intergenic
1192249924 X:69403525-69403547 GTGTTACAATGCCCTTGAATGGG - Intergenic
1193849031 X:86512835-86512857 GAGTCAGAAAGCCATAAAATAGG + Intronic
1195995357 X:110726083-110726105 TTGAAAGAAACCCCTAGAATAGG + Intronic
1196257590 X:113539871-113539893 ATGTGAGAAAGACCTAGAAAGGG + Intergenic
1197776860 X:130123932-130123954 GTGAAGGAAAAGCCTAGAATAGG + Intergenic
1197905843 X:131424838-131424860 GAGCAAGCAAGCCCTAAAATGGG - Intergenic
1198762215 X:140044256-140044278 GTGAAAGACAACCATAGAATGGG - Intergenic
1198928503 X:141825820-141825842 GGGTAAGGAAGCCCCACAATTGG + Intergenic
1200698428 Y:6381721-6381743 GGGTATGAAAGCCCTCAAATCGG + Intergenic
1200699703 Y:6391678-6391700 GGGTATGAAAGCCCTCAAATCGG + Intergenic
1200705886 Y:6442119-6442141 GAGTATGAAAGCCCTCAAATCGG + Intergenic
1200913012 Y:8547608-8547630 GGGTATGAAAGCCCTCAAATAGG - Intergenic
1200914709 Y:8561377-8561399 GGGTATGAAAGCCCTCAAATTGG - Intergenic
1200918136 Y:8589515-8589537 GTGTATGAAAGCTCTCAAATTGG - Intergenic
1200927509 Y:8667820-8667842 GGGTATGAAAGCCCTCAAATTGG - Intergenic
1200932230 Y:8707437-8707459 GGGTATGAAAGCCCTCAAATCGG + Intergenic
1201028224 Y:9722589-9722611 GAGTATGAAAGCCCTCAAATCGG - Intergenic
1201034408 Y:9773020-9773042 GGGTATGAAAGCCCTCAAATCGG - Intergenic
1201035686 Y:9782978-9783000 GGGTATGAAAGCCCTCAAATCGG - Intergenic
1202148169 Y:21821532-21821554 GGGTATGAAAGCCCTCAAATCGG - Intergenic
1202148487 Y:21823988-21824010 GGGTATGAAAGCCCTCAAATGGG - Intergenic
1202181527 Y:22143910-22143932 GAGTATGAAAGCCCTCAAATTGG + Intergenic
1202209833 Y:22442490-22442512 GAGTATGAAAGCCCTCAAATTGG - Intergenic