ID: 1061640363

View in Genome Browser
Species Human (GRCh38)
Location 9:131949529-131949551
Sequence TGTGTAAGAAAGCCCTAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061640363_1061640366 5 Left 1061640363 9:131949529-131949551 CCATTCTAGGGCTTTCTTACACA 0: 1
1: 0
2: 2
3: 11
4: 155
Right 1061640366 9:131949557-131949579 GTGCTTTTATTAGGTCTGCGAGG No data
1061640363_1061640368 24 Left 1061640363 9:131949529-131949551 CCATTCTAGGGCTTTCTTACACA 0: 1
1: 0
2: 2
3: 11
4: 155
Right 1061640368 9:131949576-131949598 GAGGATTCCTTGGAAAAAGCAGG No data
1061640363_1061640367 14 Left 1061640363 9:131949529-131949551 CCATTCTAGGGCTTTCTTACACA 0: 1
1: 0
2: 2
3: 11
4: 155
Right 1061640367 9:131949566-131949588 TTAGGTCTGCGAGGATTCCTTGG No data
1061640363_1061640364 -4 Left 1061640363 9:131949529-131949551 CCATTCTAGGGCTTTCTTACACA 0: 1
1: 0
2: 2
3: 11
4: 155
Right 1061640364 9:131949548-131949570 CACACCGCAGTGCTTTTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061640363 Original CRISPR TGTGTAAGAAAGCCCTAGAA TGG (reversed) Intronic
900893169 1:5464348-5464370 TATGTAAGAAAGCCCTCAACGGG + Intergenic
904747337 1:32719352-32719374 GATGTAAGAAATCCTTAGAAAGG + Intergenic
907037119 1:51226163-51226185 TGAGTAAGAAGGCCCTAGAATGG + Intergenic
908884612 1:68773967-68773989 TGTGTGAGAGAGGCCCAGAAGGG - Intergenic
909112915 1:71502921-71502943 TGTGCAAGAAACCTCTAGTAGGG + Intronic
909764546 1:79339106-79339128 TATGTTAGAAAGCCATAGACTGG - Intergenic
910418057 1:87022608-87022630 TGTGGAAGTGGGCCCTAGAAGGG + Intronic
912333637 1:108842800-108842822 AGCCTAAGAAAACCCTAGAAAGG - Intronic
912793250 1:112674341-112674363 TGCGTCTGAAAGCCCGAGAAGGG + Intronic
912975809 1:114329246-114329268 ATTGTGAGAAAGCCCTACAATGG + Intergenic
914256330 1:145962970-145962992 TGTGTAAGAAAGGTGTAGAAAGG + Intronic
918391183 1:184064419-184064441 TTGGTGAGAAAGCCCTAGATTGG + Intronic
919682705 1:200452209-200452231 TCTCTAAGAAAGCCCCAGATTGG - Intergenic
921293603 1:213681427-213681449 TGTGTAAGGATGCCTTTGAAGGG + Intergenic
921939408 1:220824600-220824622 TGTGGAAGATACACCTAGAACGG - Intergenic
924771973 1:247087299-247087321 TAGGTAAGAAAGCCCCAGGAGGG + Intergenic
1065013997 10:21444698-21444720 TTTTTAAAAAAGCCCAAGAAAGG + Intergenic
1067319146 10:45200556-45200578 TGTGTGTGAAAGCCATTGAAAGG - Intergenic
1067785616 10:49243448-49243470 TGTGGAAGAAAGGACTGGAAGGG + Intergenic
1068527095 10:58142825-58142847 GATCTAAGAAAGACCTAGAAAGG - Intergenic
1069313878 10:67073817-67073839 TGTGAAACAAAGACTTAGAAAGG - Intronic
1070571213 10:77640247-77640269 TGTCTAAGAAGGCCCCAGAGGGG - Intergenic
1071102706 10:82057925-82057947 TGAGTAAGCAAGCACTAGAATGG - Intronic
1073896988 10:108173035-108173057 TGAAAAAGAAAGCCATAGAATGG - Intergenic
1074271977 10:111962956-111962978 CATGTGAGCAAGCCCTAGAAGGG - Intergenic
1076143364 10:128097059-128097081 AGTGTAAGAAAGCCCAAGAGAGG + Exonic
1080263749 11:30379136-30379158 TGTATTTGAAAGCCGTAGAATGG + Intergenic
1080606333 11:33868379-33868401 TGTGTAACAAATCCCTTCAAAGG + Intronic
1081674984 11:44963431-44963453 TGAGTGAGAAAGCCCTCAAAAGG + Intergenic
1082772224 11:57216954-57216976 TATGTAACAAAGACCTGGAAAGG - Intergenic
1083301561 11:61742339-61742361 TGTGTGGGAAGGTCCTAGAAAGG - Intronic
1085940007 11:81197578-81197600 TGTGTAAGAAACCTCCAGTAGGG + Intergenic
1086542918 11:87934032-87934054 TGTGTAAGAAAGGACTTGAAAGG - Intergenic
1086827690 11:91519436-91519458 TTTTTAAGAAAGCCCTGGCAGGG + Intergenic
1087972531 11:104502148-104502170 ACTGTAAGATGGCCCTAGAATGG - Intergenic
1088865980 11:113848500-113848522 TGTGTCACGAAGCCCCAGAAAGG - Intronic
1090718305 11:129450003-129450025 TGTGTATGAAAGGACCAGAACGG - Intronic
1091388642 12:111537-111559 TGTGTAAGAAACCTCCAGTAAGG - Intronic
1091636050 12:2197497-2197519 TATGTAATAAAGCCCTATTATGG + Intronic
1091681574 12:2531326-2531348 AGTGGAAAGAAGCCCTAGAAAGG + Intronic
1093507829 12:19889243-19889265 TGTATAAGAAATCACTGGAAAGG - Intergenic
1095328304 12:40925046-40925068 TATGTAACTAAACCCTAGAAGGG + Intronic
1099404486 12:82243949-82243971 TGTGTAAGATAGGTATAGAAAGG - Intronic
1101082695 12:101205235-101205257 TGAGTAAGCAAGCCTTGGAAAGG - Intronic
1101295792 12:103422619-103422641 TGTCTAAGAAACCTGTAGAATGG + Intronic
1101999722 12:109549770-109549792 TGTGCATGAAAGTCCTAGAGAGG - Intergenic
1107703209 13:43070795-43070817 CGTGAAAGAAAGCCCTTGGAAGG + Intronic
1108181032 13:47840302-47840324 TGTGTATGAATGCCTTATAATGG - Intergenic
1109617093 13:64849285-64849307 TGTGAAAGAAATCCCTAGGAAGG - Intergenic
1110054528 13:70949526-70949548 TGTGTAAGAAAGTAAGAGAAGGG + Intergenic
1116299213 14:43155440-43155462 TGTGTAAGGAAGTCATAGACTGG - Intergenic
1116688387 14:48072805-48072827 TTTGTAAGAAAGCACGAGAGTGG + Intergenic
1121465403 14:94112402-94112424 TGTGGAAAAAAGCAATAGAATGG - Intronic
1121506032 14:94477674-94477696 TGTGGAAGAAAACCCAAGGAGGG + Intronic
1124507367 15:30289891-30289913 TGAGTAACACAGCCCCAGAAGGG - Intergenic
1124736188 15:32248768-32248790 TGAGTAACACAGCCCCAGAAGGG + Intergenic
1126157741 15:45581287-45581309 TGTGTTAGTAACCCCAAGAAAGG + Intergenic
1126870756 15:52984327-52984349 TGTGTAAGACAAACCTAGAGTGG + Intergenic
1127518675 15:59721518-59721540 TTTATTAGAAAGCCTTAGAAAGG - Intergenic
1129798207 15:78394069-78394091 TGTGTAAGAAAACCCATGGAAGG - Intergenic
1134287474 16:12874670-12874692 TGTTAAAGACAGCCCTAAAATGG + Intergenic
1134361836 16:13538324-13538346 TGTTTATAAAAGCCCGAGAAAGG - Intergenic
1134890260 16:17835325-17835347 TGCGTATGAAAGGACTAGAAGGG - Intergenic
1137245635 16:46701683-46701705 TGTGTTAGAAAACTGTAGAAAGG - Intergenic
1141118433 16:81331860-81331882 TGTGAAAGAAAGCTCTTGGAAGG + Intronic
1143999137 17:11036418-11036440 TGTGTCAGAAAGCCCTACAGTGG + Intergenic
1146650442 17:34603041-34603063 TGTGTAAGACAGGCCTAGGCTGG - Intronic
1146668672 17:34721902-34721924 TTTGGAACAAAGCCCTAGAAAGG + Intergenic
1150921632 17:69490204-69490226 TGAGTTAGAAAGACCTGGAAGGG + Intronic
1153444876 18:5160057-5160079 TGTGTAGGCAAGGCCAAGAATGG - Intronic
1155061671 18:22234194-22234216 TGTGAAAGCCAGCCTTAGAAAGG - Intergenic
1156540005 18:37900258-37900280 TGTGTAAGAAAAACCAAGAGAGG - Intergenic
1161998622 19:7729923-7729945 CGAGTGAGGAAGCCCTAGAAAGG + Exonic
1165284891 19:34833295-34833317 TGTGGGAGAAAGGCCTGGAAGGG - Intergenic
927018261 2:18990897-18990919 TGTGTAAGAAAACTCAAAAATGG - Intergenic
928404140 2:31001476-31001498 TCTGTAATTAAGCCCAAGAAGGG + Intronic
928858018 2:35823518-35823540 GATGTGAGAAAGACCTAGAAAGG - Intergenic
929310672 2:40420801-40420823 TGTGTATGAAAGCCATTCAAAGG + Intronic
931148341 2:59544643-59544665 AGTGTAAGAAAACCCAAGAGAGG - Intergenic
931682658 2:64764877-64764899 TATGTAAGAAACACCTACAATGG + Intergenic
931979129 2:67675903-67675925 TGTGTAAGAAATTCTGAGAATGG + Intergenic
931983154 2:67715656-67715678 AATGTAAGAAAGCCTCAGAAGGG + Intergenic
933535806 2:83572986-83573008 TGACTAAGAAACACCTAGAAGGG + Intergenic
937331710 2:121034663-121034685 TGTGGAAGAAAGCTCTAGGGTGG + Intergenic
942497635 2:176556360-176556382 TGTCTAAGAAAAACCTAGCAAGG - Intergenic
942870765 2:180731896-180731918 TGTCTAAGAACGCCTCAGAATGG - Intergenic
943174672 2:184455739-184455761 TGTATTAGAAAGCTATAGAAAGG - Intergenic
945662336 2:212701873-212701895 TGTGTAAAAAAACCCTACACTGG + Intergenic
948317224 2:237037514-237037536 TGTGCAGGACAGCCCTAGGAGGG + Intergenic
948350480 2:237336115-237336137 TGGGTAAGAAAGCCCTTGCTAGG - Exonic
1172262808 20:33583004-33583026 TGTATAAGAAAAAACTAGAAGGG - Intronic
1177343477 21:19836551-19836573 TGTGTAAGTGAGCCATAGTATGG + Intergenic
1177909275 21:27010769-27010791 TCTGTAAGAAAGACCGAGGAGGG - Intergenic
1179194175 21:39150242-39150264 TGTGTAACAGAGCCCTAAAAGGG - Intergenic
1179973939 21:44852921-44852943 TTTGTAATAAAGCCATTGAATGG - Intronic
952448000 3:33402162-33402184 TCTGCAGCAAAGCCCTAGAATGG + Intronic
952569073 3:34692522-34692544 TGTATAAGATATCACTAGAATGG - Intergenic
953460024 3:43074471-43074493 TGTTTAAGAAATCCTTGGAAGGG - Intergenic
954009286 3:47620743-47620765 AGTGTGAGAAAGCCCAAGGATGG + Intronic
956134699 3:66087293-66087315 AGTGTAAAGAAGCCTTAGAAGGG + Intergenic
957660688 3:83147713-83147735 TATGTGATAAAGCCTTAGAAAGG - Intergenic
957672032 3:83317570-83317592 TGTCTAAGAAAGCCCTGAACAGG + Intergenic
958451298 3:94276357-94276379 TTTTTAAGAAGCCCCTAGAATGG - Intergenic
958595542 3:96217274-96217296 TGAGTAAGAAAGCCATATATGGG - Intergenic
958810043 3:98850600-98850622 TGTGTAAGAAAGCCTGAATAAGG + Intronic
959386025 3:105708130-105708152 TGTGGAAGAAAGCCCAGAAAAGG - Intronic
959396833 3:105850936-105850958 TTTGTAAGAAACCCCTTGACTGG - Intronic
959764472 3:110009008-110009030 TGTGTGGGAAATCCCTAGATAGG - Intergenic
962435483 3:135362654-135362676 TGTGTAAGAAATGACTAGAAAGG - Intergenic
963580488 3:147120758-147120780 TGTGTAAGAAAACCAAAGAGAGG - Intergenic
965215583 3:165860439-165860461 TGTGTAAGAAATACCATGAAAGG - Intergenic
966321388 3:178705039-178705061 TGGCTTAGAAAACCCTAGAAAGG - Intronic
974277685 4:59746294-59746316 TTTGTTATAAAGCCTTAGAAAGG + Intergenic
975591994 4:76010288-76010310 TGTGTAAGAAGAGGCTAGAAAGG - Intergenic
977922799 4:102664276-102664298 TGTTGAAGACAGCCCTAAAAAGG + Intronic
978408360 4:108403251-108403273 AGTCCAAGAAAGCCTTAGAAAGG - Intergenic
979198601 4:117949939-117949961 TTTGGAAGAAAGCTCCAGAAAGG + Intergenic
979211507 4:118109958-118109980 TGTTTAACAAAGCACTAAAAGGG - Intronic
980793184 4:137646534-137646556 GGGGGAAGAAAACCCTAGAAAGG + Intergenic
983536915 4:168867625-168867647 TGTGAAAGAAACCACCAGAAGGG - Intronic
984447872 4:179860081-179860103 TGTTTAAGTAACCCATAGAATGG + Intergenic
984860390 4:184232463-184232485 TGTGTAATAAAGCACTGGACTGG - Intergenic
985105336 4:186493862-186493884 TGTGAAGGAAAGGCCCAGAAAGG - Intronic
988537174 5:32079491-32079513 TTTGTAGGACAGCCCTAAAAAGG - Intronic
993818840 5:92588743-92588765 TTTGGAAGAAAGCACTATAAAGG - Intergenic
994093887 5:95831741-95831763 TCTTTAAGAAAGCCCTAGAAAGG - Intergenic
995883130 5:116864680-116864702 TGTGGGAGAAAGCTCTGGAATGG + Intergenic
996056617 5:118989173-118989195 TGAGGAAACAAGCCCTAGAAAGG + Intergenic
996420848 5:123260475-123260497 TTTCTCAGAAATCCCTAGAATGG + Intergenic
997592959 5:135086795-135086817 TGTGGAAGAAGGGTCTAGAAGGG + Intronic
997855919 5:137372609-137372631 TGTGTCAGAAATTCCAAGAAAGG + Intronic
1000265564 5:159632957-159632979 TCTTTAAGAAAGCCATATAAAGG + Intergenic
1005002404 6:21255353-21255375 TATGTCAGAAAGCACTGGAAAGG + Intergenic
1005796430 6:29366869-29366891 TGTGTAAGAAACCCTGAGAAGGG - Intronic
1006831180 6:36969191-36969213 TCTGTAGGAGAGCCCTAGAGAGG + Intronic
1012471338 6:99576023-99576045 TGTGTTACAAACCCCTAGGAGGG + Intergenic
1013413340 6:109901874-109901896 TGTTGAAGAAAGGCATAGAAGGG + Intergenic
1013758579 6:113489342-113489364 TTTGGAGGATAGCCCTAGAAAGG + Intergenic
1014962206 6:127701000-127701022 TGTGTAATAAAGCAACAGAACGG - Intergenic
1015609041 6:134994790-134994812 TGTATAAGAAGGCCCAAGGAAGG + Intronic
1017280244 6:152616239-152616261 TGTATAAGTAAGCCGTAGACAGG + Intronic
1018244586 6:161810402-161810424 TGTCTAAGAAAACTCTTGAATGG + Intronic
1019866326 7:3713656-3713678 TGTGACAGAAAGCTGTAGAAAGG - Intronic
1020399746 7:7761927-7761949 TGTATAAAAAAGCACAAGAATGG - Intronic
1022360526 7:29652443-29652465 TGTGTAAGAGAGACTGAGAAAGG + Intergenic
1024346950 7:48322915-48322937 TTTGTGAGAATGCCCTATAATGG + Intronic
1024910171 7:54438150-54438172 TGGGAAAGAAATCGCTAGAAAGG + Intergenic
1031127069 7:117786900-117786922 TGTGTAAGAAAACCCTTGAGTGG - Intronic
1031214269 7:118870417-118870439 TGTGTAAGAAACCTCCAGTAGGG + Intergenic
1034911070 7:154999297-154999319 TGTGTAAGAAAGCCCATTTACGG - Intronic
1036605531 8:10302611-10302633 TCTGGCAAAAAGCCCTAGAATGG - Intronic
1037617099 8:20529304-20529326 TGGGAAAGAAAGCCCAAGATAGG - Intergenic
1038169090 8:25112462-25112484 TGTGTAAAATTGCCCTAGAGAGG - Intergenic
1043647635 8:82540966-82540988 TGTGGAAGAAAGACATAGCAGGG - Intergenic
1047596365 8:126381708-126381730 TTTGTGAGAAACTCCTAGAAAGG + Intergenic
1048678604 8:136813158-136813180 TTTGGAAGAAGGCCCGAGAATGG + Intergenic
1059391801 9:114004007-114004029 GGTGTAACAAACCCATAGAACGG - Intronic
1059800791 9:117747662-117747684 TGTGTTTGAAAGCCTTACAAGGG + Intergenic
1060192529 9:121602189-121602211 GTTGGGAGAAAGCCCTAGAAAGG - Intronic
1061640363 9:131949529-131949551 TGTGTAAGAAAGCCCTAGAATGG - Intronic
1185824054 X:3232175-3232197 AGAGTGAGAAAGCCCCAGAAAGG + Intergenic
1186880855 X:13864714-13864736 TGTGTATGAAAGACAGAGAATGG + Intronic
1195174491 X:102302453-102302475 TGAGTAAGTAAGTTCTAGAAAGG + Intergenic
1195184374 X:102384640-102384662 TGAGTAAGTAAGTTCTAGAAAGG - Intronic
1196257589 X:113539870-113539892 GATGTGAGAAAGACCTAGAAAGG + Intergenic
1196751916 X:119125967-119125989 TGTGCCAGAAGGCCATAGAAAGG + Intronic
1197430049 X:126351140-126351162 AGTGAAAGAAAGCTCAAGAAGGG + Intergenic
1197905844 X:131424839-131424861 TGAGCAAGCAAGCCCTAAAATGG - Intergenic
1202148488 Y:21823989-21824011 TGGGTATGAAAGCCCTCAAATGG - Intergenic