ID: 1061640365

View in Genome Browser
Species Human (GRCh38)
Location 9:131949552-131949574
Sequence CAGACCTAATAAAAGCACTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061640365_1061640368 1 Left 1061640365 9:131949552-131949574 CCGCAGTGCTTTTATTAGGTCTG 0: 1
1: 0
2: 0
3: 23
4: 320
Right 1061640368 9:131949576-131949598 GAGGATTCCTTGGAAAAAGCAGG No data
1061640365_1061640367 -9 Left 1061640365 9:131949552-131949574 CCGCAGTGCTTTTATTAGGTCTG 0: 1
1: 0
2: 0
3: 23
4: 320
Right 1061640367 9:131949566-131949588 TTAGGTCTGCGAGGATTCCTTGG No data
1061640365_1061640370 24 Left 1061640365 9:131949552-131949574 CCGCAGTGCTTTTATTAGGTCTG 0: 1
1: 0
2: 0
3: 23
4: 320
Right 1061640370 9:131949599-131949621 TTTCATTTTTGTCATTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061640365 Original CRISPR CAGACCTAATAAAAGCACTG CGG (reversed) Intronic
900252037 1:1675939-1675961 CAGACTTTATAAAAGCACCAGGG - Intronic
900262448 1:1738797-1738819 CAGACTTTATAAAAGCACCAGGG - Intronic
902963421 1:19980535-19980557 CAGTCCTAAAAAAGTCACTGTGG + Intergenic
905973374 1:42157321-42157343 CAGCCTGAATAAAGGCACTGAGG - Intergenic
906007138 1:42484541-42484563 CAGTCCTAATAGACTCACTGTGG - Intronic
906500469 1:46338415-46338437 CACACCTAATCACAGCACTTTGG + Intergenic
907921388 1:58916637-58916659 CACACCTATTAGAATCACTGAGG + Intergenic
908955301 1:69618201-69618223 CAGATCTGATCGAAGCACTGGGG + Intronic
909156759 1:72087854-72087876 CAGACCTAATCTCAGCACTTTGG - Intronic
909839270 1:80298249-80298271 CAGCCCTAATAAAACCATGGTGG - Intergenic
910646438 1:89520092-89520114 AACACATAAAAAAAGCACTGAGG - Intergenic
912111375 1:106346705-106346727 CAGACCCAATAAAAGCCCAGTGG - Intergenic
913715857 1:121533499-121533521 CAAACCTGAGAAAAGCAATGGGG - Intergenic
914050835 1:144128949-144128971 AAAGCCTAATAATAGCACTGTGG + Intergenic
914128346 1:144836494-144836516 AAAGCCTAATAATAGCACTGTGG - Intergenic
916973076 1:170045171-170045193 CAGAGCCAATAAAAGCACCTCGG + Intronic
917162668 1:172075577-172075599 CTGACCAAAAAAAAGCAATGGGG - Intronic
917184830 1:172341608-172341630 CAAAGCTGATAAAAGCATTGGGG + Intronic
917393181 1:174561731-174561753 CAAACCTGACAAAAGCAATGGGG + Intronic
919297621 1:195722269-195722291 CACAGCTCATAAAAGCAGTGTGG + Intergenic
924911228 1:248515374-248515396 CAAACCTGAGAAAAGCAATGGGG - Intergenic
924912873 1:248532666-248532688 CAAACCTGAGAAAAGCAATGGGG + Intergenic
1063528322 10:6805408-6805430 CAAACCTGAGAAAAGCAATGGGG - Intergenic
1063785259 10:9376532-9376554 CTGACCTAATATAAGCACATAGG + Intergenic
1063855914 10:10253675-10253697 CAGACCTAAGAAAATTACTTGGG + Intergenic
1064490828 10:15854684-15854706 AAGAACTAAGAGAAGCACTGAGG + Intronic
1064941520 10:20740798-20740820 CAAAGCTGATAAAAGCACTCAGG - Intergenic
1065399608 10:25283012-25283034 CTGACCTCATAAAATGACTGGGG + Intronic
1066102408 10:32129381-32129403 CAGACCCTATAAAAGCAATAAGG + Intergenic
1066476444 10:35751659-35751681 CAGAACTAATGAAAGCATTGAGG - Intergenic
1066699327 10:38110212-38110234 CAAACCTGAAAAAAGCAATGGGG + Intronic
1066960483 10:42218069-42218091 AAAGCCTAATAATAGCACTGTGG + Intergenic
1067047106 10:42991009-42991031 CTGGCCTCAGAAAAGCACTGTGG - Intergenic
1068178781 10:53495269-53495291 CAAACCTGAGAAAAGCAATGGGG - Intergenic
1068239508 10:54287639-54287661 CAGGACTATTTAAAGCACTGAGG + Intronic
1068810735 10:61253056-61253078 CAAACCTGACAAAAGCAATGGGG - Intergenic
1070903095 10:80047973-80047995 GATACCTAACAACAGCACTGTGG - Intergenic
1071012551 10:80954958-80954980 CAGAGCCAATAAAAGCCCAGTGG - Intergenic
1071130073 10:82380095-82380117 TAGACATAAAAAAAGAACTGAGG - Intronic
1071202805 10:83239400-83239422 CAAACCTAAGAAAAGCAATGGGG - Intergenic
1071548878 10:86550753-86550775 CAGACCTACTACTAGAACTGTGG + Intergenic
1071868515 10:89765161-89765183 CAAACCTGAGAAAAGCAATGGGG - Intronic
1071926324 10:90414313-90414335 CAGAGCCAATAAAAGCCCAGTGG + Intergenic
1073574459 10:104610913-104610935 CGGAGCTGATAAAAGCCCTGTGG + Intergenic
1077812816 11:5655880-5655902 CAAACCTGACAAAAGCAATGGGG + Intergenic
1078494022 11:11798054-11798076 CAAACCTGACAAAAGCAATGGGG - Intergenic
1079658272 11:23009120-23009142 CAAACCTGAGAAAAGCAATGGGG + Intergenic
1080731366 11:34958280-34958302 CCCCCCTAAAAAAAGCACTGTGG - Intronic
1081034825 11:38130850-38130872 TAGACATAATTAAAACACTGAGG - Intergenic
1081345300 11:41978447-41978469 CAGACCTATTAAAGGCCATGTGG - Intergenic
1082148458 11:48701100-48701122 CAAACCTGAGAAAAGCAATGGGG - Intergenic
1082228526 11:49736883-49736905 CAGAGCTGATAAAAGCACCTTGG - Intergenic
1082628762 11:55516495-55516517 CAAACCTGAGAAAAGCAATGGGG - Intergenic
1082903183 11:58278579-58278601 CAAACCTGACAAAAGCAATGGGG - Intergenic
1085334488 11:75680814-75680836 CAGCCATAGCAAAAGCACTGAGG - Intergenic
1086621548 11:88892265-88892287 CAGAGCTGATAAAAGCACCTTGG + Intronic
1088356559 11:108950161-108950183 CAGACCTGACAAAAGCAATGAGG - Intergenic
1092297647 12:7213452-7213474 CAAACCTGACAAAAGCAATGGGG + Intronic
1093388488 12:18587978-18588000 CAAACCTGACAAAAGCAATGGGG + Intronic
1093853200 12:24066096-24066118 CAGAACTAACAAATGCACTTGGG + Intergenic
1094226565 12:28052751-28052773 CATTCCTAATAATAGCACTGAGG - Intergenic
1094299390 12:28944909-28944931 CTGACCAAAAAAAAGCAATGGGG - Intergenic
1096063716 12:48723395-48723417 CAGACCTAATAATAGAATTATGG + Intergenic
1098436580 12:70474589-70474611 CAAACCTGACAAAAGCAATGGGG + Intergenic
1099396933 12:82151718-82151740 CAGGCATCATAAAATCACTGAGG + Intergenic
1099468173 12:83012839-83012861 CATACCTAATAAAACAACAGAGG - Intronic
1100007185 12:89908639-89908661 CAGACATAATGAAAACAGTGAGG - Intergenic
1100133374 12:91523537-91523559 AAGACATAATAAAAGCACACTGG - Intergenic
1100754852 12:97739961-97739983 GAGAGCTAATGAAAGCAATGAGG + Intergenic
1100858860 12:98783669-98783691 CAGAACTAATACATGCACAGAGG + Intronic
1100950570 12:99844504-99844526 CAGACTTGACAAAAGCAATGGGG - Intronic
1101383246 12:104232645-104232667 CAGAGCCAATAAAAGCCCTTGGG - Intronic
1101871356 12:108568177-108568199 AAGGCCTAATAAAAGGGCTGGGG - Intronic
1102452780 12:113054228-113054250 CAGAGCTAGAAAAATCACTGTGG + Intergenic
1104100428 12:125603327-125603349 CAAACCTGACAAAAGCAATGGGG + Intronic
1106853961 13:33827866-33827888 CAGACCTAAAAAAAACTCTCTGG - Intronic
1106973418 13:35174655-35174677 CAAACCAAATAAGAGCACTATGG - Intronic
1108543064 13:51462263-51462285 CAGAACACATAAAAGCACTGTGG + Intergenic
1108600314 13:51987785-51987807 CAAACCTGACAAAAGCAATGGGG + Intronic
1109118752 13:58426686-58426708 CAAACCTGACAAAAGCAATGGGG + Intergenic
1109865563 13:68259480-68259502 CAGAGCTGATAAAAGCCCTGTGG + Intergenic
1112463107 13:99620350-99620372 CAGACCCTATGAGAGCACTGTGG - Intronic
1112942700 13:104884610-104884632 CAAACCTAACAAAAGCAATGGGG - Intergenic
1112955855 13:105057139-105057161 CAAACCTCCTAAAATCACTGTGG - Intergenic
1113177119 13:107577580-107577602 CAGAGCTAATAAATTCAGTGAGG - Intronic
1114177820 14:20339256-20339278 CAGATGAAATCAAAGCACTGGGG + Intergenic
1116035225 14:39619318-39619340 CAGAATTATGAAAAGCACTGTGG - Intergenic
1116514769 14:45792102-45792124 CAGAGCTAATAAAAGCCCCTTGG + Intergenic
1117491643 14:56254067-56254089 CAAACCTGACAAAAGCAATGGGG + Intronic
1118286057 14:64474512-64474534 CAGATCTTTTAAAAGAACTGTGG + Intronic
1118558668 14:67054822-67054844 CAAACCTGACAAAAGCAATGGGG + Intronic
1119452952 14:74727872-74727894 CAAACCTGAGAAAAGCAATGGGG - Intronic
1120331130 14:83093458-83093480 TACAGCTCATAAAAGCACTGTGG - Intergenic
1120643379 14:87042674-87042696 CAGACCTTATAAAACCATTTAGG + Intergenic
1120912982 14:89684517-89684539 CAGAGCCAATAAAAGCCCTTTGG + Intergenic
1121057601 14:90872653-90872675 CAGAACCAGTAAAAGCAATGGGG - Intronic
1202931817 14_KI270725v1_random:44639-44661 AAAGCCTAATAATAGCACTGTGG - Intergenic
1123420704 15:20128275-20128297 AAAGCCTAATAATAGCACTGTGG + Intergenic
1123445157 15:20325250-20325272 AAAGCCTAATAATAGCACTGTGG - Intergenic
1123529929 15:21134804-21134826 AAAGCCTAATAATAGCACTGTGG + Intergenic
1123799290 15:23803832-23803854 TACAGCTCATAAAAGCACTGTGG - Intergenic
1124947979 15:34288251-34288273 CAAACCTGACAAAAGCAATGGGG - Intronic
1124984834 15:34597128-34597150 AAGACCAAATAAAAGAATTGTGG - Intergenic
1125169288 15:36747848-36747870 CTGACCTAATACAAGACCTGAGG + Intronic
1126451074 15:48810416-48810438 CAGTGCTAATAACAGCACTTTGG + Intronic
1126746236 15:51829203-51829225 CATACCTAAGAAAACCACTAAGG + Intergenic
1128149247 15:65352452-65352474 TAGAGCTAATAAAAGCCCTTTGG + Intronic
1130678001 15:85971077-85971099 CAAACCCAACAAAAGCAATGGGG - Intergenic
1130737063 15:86561422-86561444 CAAACCCAACAAAAGCAATGGGG - Intronic
1130745894 15:86653578-86653600 CAAAGCTAATAAAAGCACCAAGG + Intronic
1131093209 15:89639017-89639039 CAAACCTGAGAAAAGCAATGGGG + Intronic
1134027462 16:10965222-10965244 CAGGGCTTATAAAAGCACTGTGG - Intronic
1134624633 16:15714851-15714873 CAGGCCAGAGAAAAGCACTGGGG - Intronic
1135077367 16:19405030-19405052 CAGAGCCAATAAAAGCCCAGGGG - Intergenic
1135316650 16:21452139-21452161 CAGAATTAATAAAAGCACAGAGG + Intergenic
1135369573 16:21884384-21884406 CAGAATTAATAAAAGCACAGAGG + Intergenic
1135442241 16:22486743-22486765 CAGAATTAATAAAAGCACAGAGG - Intronic
1136313317 16:29430839-29430861 CAGAATTAATAAAAGCACAGAGG + Intergenic
1136326760 16:29532605-29532627 CAGAATTAATAAAAGCACAGAGG + Intergenic
1136441451 16:30272589-30272611 CAGAATTAATAAAAGCACAGAGG + Intergenic
1136721606 16:32323357-32323379 AAGCCTTAATAATAGCACTGTGG + Intergenic
1136865559 16:33749561-33749583 CAAACCTGACAAAAGCAATGGGG - Intergenic
1137366826 16:47866807-47866829 CAAACTTAAAAAAAGCAATGCGG - Intergenic
1138250911 16:55501291-55501313 CAGAAAGAATACAAGCACTGTGG - Intronic
1138410561 16:56836361-56836383 CAGACTTACTAGAAGCACAGAGG - Intronic
1138799519 16:60010938-60010960 AAGACATAATAAAAGCACATTGG + Intergenic
1139888244 16:70226330-70226352 CAGAATTAATAAAAGCACAGAGG + Intergenic
1140263916 16:73404027-73404049 CAGATCTTAGAAAAGCACTGAGG + Intergenic
1140684623 16:77421430-77421452 CAGGCCTAATGATAGCACTAAGG - Intronic
1203004826 16_KI270728v1_random:194413-194435 AAGCCTTAATAATAGCACTGTGG - Intergenic
1203106592 16_KI270728v1_random:1366551-1366573 CAAACCTGACAAAAGCAATGGGG + Intergenic
1203126922 16_KI270728v1_random:1595817-1595839 CAAACCTGACAAAAGCAATGGGG - Intergenic
1203136376 16_KI270728v1_random:1730532-1730554 AAGCCTTAATAATAGCACTGTGG - Intergenic
1143691431 17:8569918-8569940 CAGACAGAATGAAAGAACTGAGG - Intronic
1143995138 17:10999777-10999799 CATACCTCAGAAAAGCACAGAGG + Intergenic
1150012492 17:61518256-61518278 CACAGCTAATAAAACCACTGAGG + Intergenic
1151140031 17:71982801-71982823 AAGACCCAATAAAAGAACTATGG - Intergenic
1153844950 18:9041150-9041172 CATACCTGAGAGAAGCACTGAGG - Intergenic
1155630918 18:27891220-27891242 CAAAGATAAAAAAAGCACTGGGG + Intergenic
1156038929 18:32797244-32797266 CAAACCTGACAAAAGCAATGGGG + Intergenic
1156251351 18:35355558-35355580 CAGAGAAAATAAAAGCAATGGGG + Intergenic
1163181560 19:15607931-15607953 CACAGCTCATAAAAGCAGTGTGG + Intergenic
1164069562 19:21754513-21754535 CAAACCTGACAAAAGCAATGGGG + Intronic
1164467350 19:28499147-28499169 AAGACCTCATAAGAGCAGTGGGG + Intergenic
1166036073 19:40169585-40169607 CACAGCTCATAAAAGCAGTGTGG + Intergenic
1202690243 1_KI270712v1_random:81589-81611 AAAGCCTAATAATAGCACTGTGG + Intergenic
925113880 2:1361092-1361114 CAAAGCTAGAAAAAGCACTGAGG - Intronic
925760119 2:7176780-7176802 CAAACCTGAGAAAAGCAATGGGG + Intergenic
926097641 2:10092566-10092588 TACAGCTCATAAAAGCACTGGGG - Intergenic
926347370 2:11960207-11960229 CAAACCTGATGAAAGCAATGGGG + Intergenic
926685695 2:15696084-15696106 CACACCTCATAAATGCAGTGTGG + Intronic
927266161 2:21153554-21153576 CAAACCTGACAAAAGCAATGAGG + Intergenic
927440212 2:23110254-23110276 CAAACCTGAAAAAAGCAATGGGG - Intergenic
929624046 2:43387992-43388014 CTGACCATTTAAAAGCACTGTGG - Intronic
930881451 2:56275200-56275222 CAGGCCTAATATAAAGACTGAGG - Intronic
933241422 2:79925264-79925286 CATACCTAATAAAAGTTCTAAGG - Intronic
933247516 2:79992565-79992587 CAGACCTAATGTAAGATCTGGGG + Intronic
933956175 2:87374422-87374444 AAAGCCTAATAATAGCACTGTGG - Intergenic
934240327 2:90266451-90266473 AAAGCCTAATAATAGCACTGTGG - Intergenic
934272865 2:91550297-91550319 AAAGCCTAATAATAGCACTGTGG + Intergenic
934324409 2:91999038-91999060 AAAGCCTAATAATAGCACTGTGG - Intergenic
934462782 2:94229735-94229757 AAAGCCTAATAATAGCACTGTGG - Intergenic
934833896 2:97564642-97564664 CAAACCTGACAAAAGCAATGGGG - Intronic
936148939 2:110000227-110000249 AAAGCCTAATAATAGCACTGTGG + Intergenic
936195742 2:110371143-110371165 AAAGCCTAATAATAGCACTGTGG - Intergenic
936769100 2:115890343-115890365 CAAACCTGACAAAAGCAATGAGG - Intergenic
939960764 2:148563587-148563609 CAAACCTGACAAAAGCAATGGGG + Intergenic
940335423 2:152521849-152521871 CAGACCAAATAATACCACTATGG - Intronic
940781851 2:157941603-157941625 TAGACTCAATAAAAGCAGTGGGG + Intronic
940844217 2:158622470-158622492 CAGCTCTAAAGAAAGCACTGGGG - Intronic
941240231 2:163027155-163027177 TAGAGCTCATAAAAGCAGTGTGG - Intergenic
941666202 2:168246674-168246696 CCGGCCTCAGAAAAGCACTGGGG + Intronic
942899210 2:181094094-181094116 CAAACCTGACAAAAGCAATGGGG + Intergenic
943100567 2:183480968-183480990 CAAACCTGACAAAAGCAATGGGG + Intergenic
943443638 2:187954824-187954846 CAAACCTGACAAAAGCAATGGGG + Intergenic
944171075 2:196778935-196778957 CAGAGCAAACAAGAGCACTGAGG + Exonic
946515022 2:220402457-220402479 CTGACCTAGTAGAAGCTCTGTGG - Intergenic
947190208 2:227496555-227496577 GAGACATAATAAAAGTACAGTGG + Intronic
1168825307 20:808884-808906 CAGAGCTAATAAAAGCATCTTGG + Intergenic
1169665124 20:8024849-8024871 CAGAACTAATAAATGAGCTGAGG + Intergenic
1169671721 20:8110156-8110178 CAAACCTGAGAAAAGCAATGGGG - Intergenic
1169800438 20:9507542-9507564 CACACCTGATAAAAGCCCTGGGG - Intergenic
1171030490 20:21672261-21672283 CAGACCTTAACTAAGCACTGTGG + Intergenic
1174297159 20:49556347-49556369 TAGAGCTAATAAAAGCACCTTGG + Intronic
1176593846 21:8672785-8672807 AAAGCCTAATAATAGCACTGTGG - Intergenic
1180276699 22:10649913-10649935 AAAGCCTAATAATAGCACTGTGG - Intergenic
1180551177 22:16542968-16542990 AAAGCCTAATAATAGCACTGTGG - Intergenic
1180583917 22:16868819-16868841 AAAGCCTAATAATAGCACTGTGG - Intergenic
1181352827 22:22270957-22270979 AAAGCCTAATAATAGCACTGTGG + Intergenic
1181640452 22:24194104-24194126 CAAACCTGAGAAAAGCAATGGGG + Intergenic
1182337892 22:29597390-29597412 TACAGCTCATAAAAGCACTGTGG + Intergenic
1182512450 22:30828817-30828839 CATAGCCAATACAAGCACTGGGG - Intronic
1183760098 22:39808312-39808334 CAGACCTAATCAAACAAATGAGG - Intronic
1184065634 22:42118373-42118395 CAAACCCAAGAAGAGCACTGAGG - Intergenic
1185240697 22:49743390-49743412 CAAACCTGACAAAAGCAATGGGG + Intergenic
1185312618 22:50164699-50164721 CTGACAAAATACAAGCACTGAGG + Intergenic
951427405 3:22563883-22563905 CAGGCTTAATAGAAGAACTGAGG - Intergenic
952679076 3:36070304-36070326 CAAACCTGACAAAAGCAATGGGG - Intergenic
953306273 3:41832803-41832825 CAAACCTGACAAAAGCAATGGGG - Intronic
956155289 3:66289587-66289609 CAAACCTGAAAAAAGCAATGGGG - Intronic
956945781 3:74221289-74221311 CATATCTTATAAAAGCTCTGAGG - Intergenic
957630778 3:82714254-82714276 AAGTACAAATAAAAGCACTGGGG + Intergenic
959431446 3:106259653-106259675 CAGAGCCAATAAAAGCCCAGTGG + Intergenic
959880770 3:111442414-111442436 CAAACCTGACAAAAGCAATGGGG - Intronic
959883107 3:111469159-111469181 CAAACCTGACAAAAGCAATGGGG - Intronic
960221920 3:115122594-115122616 CAGGACAAATAAAGGCACTGAGG - Intronic
960234662 3:115267960-115267982 CAAACCTGACAAAAGCAATGGGG + Intergenic
960395705 3:117134587-117134609 CAGACATAATTAAAGGTCTGAGG + Intronic
960762301 3:121086038-121086060 CAAACCTAACAAAAGCAATGGGG + Intronic
962306428 3:134291061-134291083 CAGACCTGCTAGAAGCATTGCGG - Intergenic
962524907 3:136229153-136229175 CAAACCTGAGAAAAGCAATGGGG + Intergenic
962551111 3:136493079-136493101 CACACCTAATCACAGCACTTTGG + Intronic
963458327 3:145575005-145575027 CAGATCTAATAAAAGCCCCTTGG - Intergenic
964053593 3:152424798-152424820 CAAACCTGACAAAAGCAATGGGG + Intronic
964603177 3:158526661-158526683 CAGAGCCAATAAAAACACTGGGG - Intronic
964980134 3:162668436-162668458 CAGAGCCAATAAAAGCCCAGTGG + Intergenic
965027957 3:163327230-163327252 CAGACTAAATAAAAGCCCCGTGG + Intergenic
965702737 3:171474963-171474985 CAAACCCAACAAAAGCAATGAGG + Intergenic
966430973 3:179831345-179831367 AAGACATTAGAAAAGCACTGCGG - Intronic
966523476 3:180897604-180897626 CAGAGCCAATAAAAGCCCAGTGG + Intronic
967531298 3:190551217-190551239 CAGAGCCAATGAAAGCTCTGGGG - Intronic
967542421 3:190683188-190683210 CAGAGCCAATAAAAGCCCTTTGG + Intergenic
967871938 3:194236923-194236945 CAGACCAAATCATAGGACTGTGG + Intergenic
969417865 4:7072895-7072917 CAGAACTGTGAAAAGCACTGTGG + Intergenic
969851581 4:9961430-9961452 CAAACCTGACAAAAGCAATGGGG + Intronic
970408509 4:15786098-15786120 TACAGCTCATAAAAGCACTGTGG + Intronic
971136898 4:23878633-23878655 CACACCTCATTTAAGCACTGTGG - Intronic
971834264 4:31742012-31742034 CACACATAATATAAGCAATGAGG + Intergenic
972756008 4:42046956-42046978 CAAACCTGACAAAAGCAATGGGG + Intronic
973167469 4:47095272-47095294 CAGACCAAGCAGAAGCACTGGGG + Intronic
973999674 4:56499139-56499161 CAAACCTGACAAAAGCAATGGGG + Intronic
974665509 4:64956270-64956292 CAGAACCAATAAAAGCCCAGTGG + Intergenic
975249770 4:72165039-72165061 CAAACCTGAGAAAAGCAATGGGG - Intergenic
975843584 4:78501986-78502008 CAAACCTGACAAAAGCAATGGGG - Intronic
976345152 4:83992114-83992136 CAGAGCCAATAAAAGCCCAGTGG + Intergenic
976805596 4:89043067-89043089 CAGACATCATATCAGCACTGGGG + Intronic
979390989 4:120127653-120127675 CAAACCTGACAAAAGCAATGGGG + Intergenic
979421828 4:120513986-120514008 CAAACCTGACAAAAGCAATGGGG + Intergenic
979587764 4:122441350-122441372 CAAACCTGACAAAAGCAATGGGG - Intergenic
979910929 4:126364716-126364738 CACACCTAATAACAGCACCATGG + Intergenic
980823969 4:138052350-138052372 CACAGCTCATAAAAGCAGTGTGG + Intergenic
981255694 4:142658737-142658759 CAGAGCCAATAAAAGCCCAGTGG + Intronic
982148988 4:152431175-152431197 GAGACGAAATAAAAGCAGTGTGG + Intronic
982217169 4:153092409-153092431 CAGGCCTATTGAAATCACTGTGG + Intergenic
982319939 4:154067386-154067408 CAGACCTGAAAACAGCCCTGTGG - Intergenic
983179884 4:164635375-164635397 CTGACCAAAAAAAAGCAATGGGG + Intergenic
988279384 5:29126745-29126767 TACAGCTCATAAAAGCACTGTGG + Intergenic
988567269 5:32329456-32329478 CTGATCTACTCAAAGCACTGAGG - Intergenic
988607377 5:32690422-32690444 CAGACAAAATACAAGCAATGGGG - Intronic
988626279 5:32878561-32878583 CAAACCTGACAAAAGCATTGGGG + Intergenic
989364764 5:40643347-40643369 CAAACCTGAGAAAAGCAATGGGG - Intergenic
991210935 5:64103893-64103915 CAAACCTGAGAAAAGCAATGGGG + Intergenic
992465690 5:77001528-77001550 CTGACTTACTAAAACCACTGTGG + Intergenic
993133362 5:83926835-83926857 AATACCTCATAAAATCACTGTGG - Intergenic
993522770 5:88924264-88924286 CTGACCTACTAAATGCACTTGGG - Intergenic
993547875 5:89235086-89235108 CAGACTTAAGAAAAGCACCTAGG - Intergenic
994004633 5:94823312-94823334 CAAACCTGACAAAAGCAGTGGGG - Intronic
995257893 5:110068223-110068245 CAAACCTAACAAAAGCAACGGGG - Intergenic
995378303 5:111502911-111502933 CAAATCTAATAAGAGAACTGAGG + Intronic
995552063 5:113291659-113291681 CAGAGCTAATAAAACCCCTCAGG - Intronic
995959707 5:117824991-117825013 CAAACCTGACAAAAGCAATGCGG - Intergenic
996366829 5:122710880-122710902 CAAACCTGAGAAAAGCAATGGGG - Intergenic
997012527 5:129895386-129895408 CAAACCTGAGAAAAGCAATGGGG - Intergenic
997217411 5:132124695-132124717 CAAACCTGACAAAAGCAATGGGG - Intergenic
997614302 5:135236063-135236085 CAGACCTAGTCAAACCCCTGGGG - Intronic
1000798666 5:165696568-165696590 CAAACCTGATGAAAGCAATGGGG + Intergenic
1004511786 6:16289124-16289146 CACAGCTCATAAAAGCAGTGTGG - Intronic
1005491130 6:26348341-26348363 TAAACATGATAAAAGCACTGTGG + Intergenic
1008297179 6:49792750-49792772 CAAACCTGAGAAAAGCAATGGGG - Intergenic
1012312125 6:97738448-97738470 CAAACCTGACAAAAGCAATGGGG + Intergenic
1012686439 6:102256402-102256424 CAAACCTGACAAAAGCATTGGGG + Intergenic
1012782023 6:103572652-103572674 CATGCATAATAAAAGCACTTAGG - Intergenic
1013981401 6:116133934-116133956 CAGCACTAATAAGATCACTGGGG - Intronic
1016413257 6:143805903-143805925 CAGACAGAAAAAAAGCCCTGAGG - Intronic
1017343616 6:153355283-153355305 CAGAGCCAATAAAAGCCCAGTGG + Intergenic
1020677045 7:11195588-11195610 CAGAGCCAATAAAAGCCCCGTGG + Intergenic
1021011541 7:15474423-15474445 CAAACCTGACAAAAGCAATGGGG + Intronic
1021185782 7:17563173-17563195 CAAACCTGACAAAAGCAATGCGG + Intergenic
1021429227 7:20540686-20540708 CTGACCAAAAAAAAGCAATGGGG + Intergenic
1021893431 7:25210557-25210579 CAGACCTCATAAAATCAGTTTGG + Intergenic
1022354476 7:29599846-29599868 CAGTCCCCATAGAAGCACTGTGG + Intergenic
1022550745 7:31236885-31236907 CCTACATAATAAAAGCACTAGGG + Intergenic
1022694774 7:32693365-32693387 CAGACCTAAGAAATACAATGGGG - Intergenic
1023301354 7:38775625-38775647 CAGACCTACTAAAATCAATAGGG - Intronic
1024590499 7:50878306-50878328 CAAACCTGACAAAAGCAATGGGG + Intergenic
1027477557 7:78652499-78652521 CAAACCTGACAAAAGCAATGGGG + Intronic
1028144749 7:87309280-87309302 CAAACCTGACAAAAGCAATGGGG + Intergenic
1029021272 7:97367079-97367101 CAAACCTGACAAAAGCAATGGGG + Intergenic
1029313541 7:99690172-99690194 CAAACCTGACAAAAGCAATGGGG + Intronic
1029412685 7:100425896-100425918 CAAACCAAATAAAAGCTCTTTGG + Intronic
1030135632 7:106244811-106244833 CAAACCTGAGAAAAGCAATGGGG - Intergenic
1030446376 7:109650690-109650712 CAAACCTGACAAAAGCAATGGGG - Intergenic
1030449250 7:109688395-109688417 CAAACCTGACAAAAGCAATGGGG - Intergenic
1031099627 7:117463353-117463375 CAAACCTGACAAAAGCAATGGGG + Intergenic
1031445368 7:121846873-121846895 CAGATCTAATAAAAGCTTTGAGG - Intergenic
1032319178 7:130869095-130869117 CAGACCTCTTCACAGCACTGGGG + Intergenic
1033885254 7:145936245-145936267 CAGACAGAAGAAAAACACTGGGG + Intergenic
1037284974 8:17289468-17289490 CAAACCTGACAAAAGCAATGGGG - Intronic
1037518966 8:19661479-19661501 CAACCCTCATACAAGCACTGTGG - Intronic
1038147410 8:24912018-24912040 CAGAACTAACAACAGCGCTGGGG - Intergenic
1039008421 8:33066883-33066905 CAATCCTTATAAAAGCAATGAGG + Intergenic
1039184070 8:34897477-34897499 CAGAGCTGATAAAAGCCCCGTGG + Intergenic
1040990592 8:53345964-53345986 CAGAGCCAATAAAAGCCCAGTGG + Intergenic
1041826712 8:62102789-62102811 AACACCTAATAAAAGAAATGCGG + Intergenic
1042086446 8:65114594-65114616 AATACCGAATCAAAGCACTGTGG - Intergenic
1042270446 8:66950371-66950393 CAAACCTGAGAAAAGCAATGGGG - Intronic
1042609740 8:70585152-70585174 CAAACCTGACAAAAGCAATGGGG + Intronic
1042968876 8:74386453-74386475 CAAACCTGACAAAAGCAATGAGG - Intronic
1043600126 8:81927710-81927732 CAGAATAAATAAAAGAACTGAGG + Intergenic
1044748803 8:95396835-95396857 CATGCCTAATCAAAGCACTTAGG + Intergenic
1045921246 8:107532066-107532088 CACACCCATGAAAAGCACTGAGG - Intergenic
1045971925 8:108088460-108088482 CAAACCTGACAAAAGCAGTGGGG + Intergenic
1049087484 8:140489880-140489902 TATAGCTCATAAAAGCACTGTGG + Intergenic
1052327446 9:27230814-27230836 CAAACCTGACAAAAGCAATGGGG + Intergenic
1052979702 9:34438935-34438957 TACACCTCATAAAAGCAGTGTGG - Intronic
1053939981 9:43238404-43238426 AAAGCCTAATAATAGCACTGTGG - Intergenic
1055203087 9:73691818-73691840 CAAACCTAATTTAAGCACAGTGG + Intergenic
1055764367 9:79645649-79645671 AAGACCTATTAACAGCATTGAGG + Intronic
1057712225 9:97456549-97456571 CAAACCTGACAAAAGCAATGGGG + Intronic
1058582489 9:106473576-106473598 CAAACCTGACAAAAGCAATGAGG - Intergenic
1058802049 9:108553892-108553914 CAGAACTAATAAACCCACTTTGG - Intergenic
1060814869 9:126629839-126629861 GAGACTTCCTAAAAGCACTGTGG + Intronic
1061640365 9:131949552-131949574 CAGACCTAATAAAAGCACTGCGG - Intronic
1203623980 Un_KI270749v1:153015-153037 AAAGCCTAATAATAGCACTGTGG - Intergenic
1186061152 X:5708934-5708956 CAGACTTCATAAAACCACTCGGG + Intergenic
1186670750 X:11764984-11765006 CAGGACTAAGAAAAGCATTGGGG - Intronic
1186726142 X:12360996-12361018 CAGACCTAAAGGAAGCTCTGAGG + Intronic
1186912932 X:14188888-14188910 CAAACCTGACAAAAGCAATGGGG - Intergenic
1187864144 X:23708777-23708799 CAGATATAATAAAGGCATTGAGG + Intronic
1190600222 X:52084485-52084507 CTGACCAAAAAAAAGCAATGGGG - Intergenic
1193228910 X:79019900-79019922 CAAAGCCAATAAAAGCGCTGTGG + Intergenic
1193346473 X:80409969-80409991 CAAACCTGAGAAAAGCAATGGGG + Intronic
1193945262 X:87725910-87725932 CAGAGCCAATAAAAGCCCAGTGG - Intergenic
1194216970 X:91142510-91142532 CAAACCTGACAAAAGCACTAGGG + Intergenic
1194741460 X:97579436-97579458 CAAACCTGAGAAAAGCAATGGGG - Intronic
1194808470 X:98360241-98360263 CAAACCTAACAAAAGCAATGGGG - Intergenic
1196260228 X:113570483-113570505 CAAACCTGACAAAAGCAATGGGG - Intergenic
1198477241 X:137007343-137007365 CAAACCTGACAAAAGCAATGGGG + Intergenic
1199234014 X:145470480-145470502 CAGAGCCAATAAAAGCCCAGTGG + Intergenic
1200205552 X:154313093-154313115 CAGACCTAATAAAAGAGAAGGGG - Intronic
1200850800 Y:7881167-7881189 CCTACCTATAAAAAGCACTGTGG - Intergenic
1201324886 Y:12745522-12745544 CAGAGCCAATAAAAGCCCTTTGG - Intronic
1201908611 Y:19110187-19110209 CAAACCTGAGAAAAGCAATGGGG - Intergenic
1202586425 Y:26433041-26433063 CAAACCTGACAAAAGCAATGGGG + Intergenic