ID: 1061640368

View in Genome Browser
Species Human (GRCh38)
Location 9:131949576-131949598
Sequence GAGGATTCCTTGGAAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061640363_1061640368 24 Left 1061640363 9:131949529-131949551 CCATTCTAGGGCTTTCTTACACA 0: 1
1: 0
2: 2
3: 11
4: 155
Right 1061640368 9:131949576-131949598 GAGGATTCCTTGGAAAAAGCAGG No data
1061640362_1061640368 25 Left 1061640362 9:131949528-131949550 CCCATTCTAGGGCTTTCTTACAC 0: 1
1: 0
2: 1
3: 13
4: 139
Right 1061640368 9:131949576-131949598 GAGGATTCCTTGGAAAAAGCAGG No data
1061640361_1061640368 26 Left 1061640361 9:131949527-131949549 CCCCATTCTAGGGCTTTCTTACA 0: 1
1: 0
2: 1
3: 10
4: 168
Right 1061640368 9:131949576-131949598 GAGGATTCCTTGGAAAAAGCAGG No data
1061640365_1061640368 1 Left 1061640365 9:131949552-131949574 CCGCAGTGCTTTTATTAGGTCTG 0: 1
1: 0
2: 0
3: 23
4: 320
Right 1061640368 9:131949576-131949598 GAGGATTCCTTGGAAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061640368 Original CRISPR GAGGATTCCTTGGAAAAAGC AGG Intronic
No off target data available for this crispr