ID: 1061643136

View in Genome Browser
Species Human (GRCh38)
Location 9:131975875-131975897
Sequence GTTCCTCTCCCTTGGAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061643136_1061643139 -10 Left 1061643136 9:131975875-131975897 CCAGCTCTCCAAGGGAGAGGAAC 0: 1
1: 0
2: 3
3: 22
4: 212
Right 1061643139 9:131975888-131975910 GGAGAGGAACTACAAACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061643136 Original CRISPR GTTCCTCTCCCTTGGAGAGC TGG (reversed) Intronic
900293879 1:1938892-1938914 GTTCCTCGGCCTTGGTGGGCTGG + Exonic
901047365 1:6405262-6405284 CTTCCTCACCGTTGGTGAGCAGG + Intergenic
901224724 1:7606690-7606712 GTTCCCATCCCCTGGAGAGGAGG - Intronic
901455631 1:9361369-9361391 GTTCCACTCCCTGGGATATCTGG + Intronic
902290718 1:15432872-15432894 GATAGTCTCCCTTGGAGAGATGG - Intergenic
902843846 1:19094001-19094023 GTACCTTTCCTTTGGAGAGGTGG - Exonic
903657763 1:24959489-24959511 GTTCCTCTCCCAGGGATGGCGGG + Intronic
903680535 1:25093440-25093462 GTTCCTTTCCTATGCAGAGCAGG - Intergenic
904005666 1:27361909-27361931 TTTCCTCTCCCTGGCAGTGCTGG - Intronic
904428165 1:30445022-30445044 GTTCCTGTCCCTCCTAGAGCAGG - Intergenic
906104447 1:43283483-43283505 GTTTCTCTTCTGTGGAGAGCTGG - Intronic
906518405 1:46452981-46453003 GTTGGTCTCCCTTGGAGGGAGGG + Intergenic
908419472 1:63945901-63945923 GTCCCTCTACTTTGGAGAACTGG + Intronic
913210918 1:116581719-116581741 GTTCTTGTCCCTGAGAGAGCTGG - Intronic
915050245 1:153062568-153062590 ATTCCACTGCCTTGGAGATCAGG - Intergenic
915236336 1:154485899-154485921 GTTCCTTCCCCTTGGAGATGAGG + Intronic
915933362 1:160074602-160074624 GTTCCTTTCCCTGGAAGAGAAGG + Intergenic
918685144 1:187405537-187405559 TTTCCCCACCCTTGGAGAACTGG - Intergenic
919010769 1:191959643-191959665 GTTTTTCTGCCTTGGTGAGCTGG - Intergenic
919844489 1:201632824-201632846 TTTCTTCTCCCTTGTTGAGCTGG + Intronic
919848057 1:201654119-201654141 GTTCCTCTGCCCTGGGGAGAAGG + Intronic
922058187 1:222062181-222062203 CTTCCTCCCCACTGGAGAGCTGG - Intergenic
923268443 1:232334376-232334398 GTCACTTTCCCTTGGAGAGTTGG + Intergenic
1066321680 10:34309015-34309037 GTTCCTCTTCCTTGGGAAGTCGG - Intronic
1069861410 10:71473931-71473953 ATGCCTCTGCCTTGGAGAGCTGG + Intronic
1069932368 10:71891405-71891427 GTCTCTCTCCCTAGTAGAGCTGG - Intergenic
1070920117 10:80179298-80179320 CTTTCCCTCACTTGGAGAGCTGG + Intronic
1072520615 10:96227084-96227106 GTTGCTTTCCCTTGGAGTGTTGG + Intronic
1072627474 10:97122384-97122406 GTCTGTTTCCCTTGGAGAGCTGG - Intronic
1073146429 10:101284676-101284698 GTTCCCCACCCTTGCACAGCGGG - Intergenic
1074426960 10:113359814-113359836 CTTCTTCTCCCTTGGAGCCCAGG - Intergenic
1074593202 10:114834321-114834343 TTTCCTGTCCTTTGGAGAGAAGG + Intronic
1076382921 10:130037459-130037481 GGGCCACTCCCTTGGAGACCGGG - Intergenic
1076837134 10:133026854-133026876 GTTCCTGTCCCCCGTAGAGCAGG + Intergenic
1076870325 10:133189706-133189728 TTTCCTCACCCCTGGCGAGCCGG - Intronic
1077065930 11:640915-640937 CTTCCTCTCCCCTGCAGAGAGGG - Intergenic
1077318802 11:1931426-1931448 GTTCCTGTCCCTGGGTGAGGAGG - Intronic
1078519375 11:12051077-12051099 GTTCCTGTCCCTTGGGGAAGAGG + Intergenic
1078915576 11:15775329-15775351 GTCACTCTCACTTGGTGAGCAGG + Intergenic
1079142183 11:17818914-17818936 GTTTCCCTCCTTTGGAGAGAGGG - Intronic
1081716333 11:45252930-45252952 GATTCTCTTTCTTGGAGAGCAGG + Intronic
1082115264 11:48321196-48321218 ATTTGTCTCCCTTGGAGAGGCGG + Intergenic
1082615826 11:55357631-55357653 GTTCCTCTCCCACTGAGTGCTGG - Intergenic
1083188991 11:61036010-61036032 GTTCCCCTGCTTTGGAGAGGAGG + Intergenic
1083322473 11:61856084-61856106 GCTCCTCTCCCTTGCAGTGTGGG - Intronic
1084442053 11:69180154-69180176 GTGTCTCTCCCTTGGATAGCAGG + Intergenic
1085303829 11:75473944-75473966 TTTCCCCTCCCTTGAAGGGCCGG - Intronic
1085396271 11:76208672-76208694 CCTCCTCTCCCTGGGAGACCAGG - Intronic
1085815281 11:79730836-79730858 ATTCTTCTCCCTGTGAGAGCTGG - Intergenic
1088213101 11:107478031-107478053 TATCCTGTCCCCTGGAGAGCTGG - Intergenic
1089676186 11:120091432-120091454 GTTCCAGGCCCGTGGAGAGCAGG + Intergenic
1090474905 11:127011176-127011198 TTTCCTTTCCCATGGGGAGCAGG - Intergenic
1091849018 12:3680152-3680174 ATTCCTGTCCCTTGTAGACCTGG - Intronic
1091891466 12:4058325-4058347 ATTCCTCTCCCTTTGAGTGTGGG - Intergenic
1091933709 12:4417778-4417800 GTTCCTCACCCCTGGAGTCCTGG - Intergenic
1093757596 12:22869924-22869946 TTTCCACTGCCTTGGAAAGCAGG + Intergenic
1095480269 12:42627327-42627349 CTTCCTGTCCTTTGGAGAGTAGG - Intergenic
1096344917 12:50837428-50837450 GTTCCTGTTCCATGGTGAGCAGG - Intergenic
1098488606 12:71049769-71049791 TTTCTTCTCCCTTGGTGAGGAGG - Intronic
1098601754 12:72339878-72339900 GTTTATCTCCCTGGGAGAGAAGG + Intronic
1100384564 12:94093537-94093559 GTGCCTCTCATTTGGAGAGAGGG - Intergenic
1101510624 12:105389511-105389533 GGCCCTCTCCCCTGGAGAGGAGG + Intronic
1103125017 12:118414318-118414340 TTTCCTCTCCCCTGCAGATCTGG + Exonic
1105890039 13:24676214-24676236 GTTCCTCTCCCGACGAGAGGAGG - Intergenic
1106628434 13:31444487-31444509 GATCCTCTCACTTGGCCAGCTGG + Intergenic
1108988204 13:56622093-56622115 GTTCCTCTGCATTGGAGAGCAGG - Intergenic
1109052751 13:57506080-57506102 GTGCCTCTCCTATGGAGAGTTGG - Intergenic
1110552728 13:76826816-76826838 GTTTCTCTCCCTGGTGGAGCTGG + Intergenic
1113329761 13:109316804-109316826 TTTGCTCTCCCTTTTAGAGCTGG - Intergenic
1114171790 14:20280152-20280174 GTTCATCTCACTGGGAGTGCTGG + Intronic
1121600376 14:95198983-95199005 GTTCCTCTCCCTGGGGGAAGAGG + Intronic
1121614992 14:95307738-95307760 GGAGCTCTCTCTTGGAGAGCTGG - Intronic
1125357143 15:38828213-38828235 GTTCCTCTGTCCTTGAGAGCAGG + Intergenic
1127489706 15:59450966-59450988 GGTCCTCTCCCTTTGAGTGTGGG - Intronic
1127682120 15:61308054-61308076 GGTCCTCTCACTTGGAGACCTGG + Intergenic
1137404841 16:48181202-48181224 GTGCCTCTCCCTGAGAGTGCCGG + Intronic
1139198023 16:64943972-64943994 GTTCCTTTTCCATGGAAAGCAGG - Exonic
1139394361 16:66628397-66628419 GGACCTCTGCCTTGGAAAGCCGG - Intronic
1139439162 16:66956048-66956070 GGACCTCTGCCTTGGAAAGCCGG - Intergenic
1139725453 16:68893967-68893989 GTTCCTGCCCCATGGAGGGCAGG - Intronic
1140729591 16:77843902-77843924 CTTCCTCTGCCAGGGAGAGCAGG + Intronic
1141471088 16:84239143-84239165 GTTCCTCTCAATTTCAGAGCCGG + Intronic
1141473489 16:84255397-84255419 GGTCCCCTCCCTTTGAGAGTGGG - Intergenic
1141519263 16:84566782-84566804 GGTCCTCTCCCCCGGGGAGCAGG + Exonic
1141851675 16:86650319-86650341 GCACCTCTCCCTTGGAGGGGAGG + Intergenic
1143519696 17:7438253-7438275 GTTCCCCCTCCTCGGAGAGCCGG - Intronic
1144074462 17:11704349-11704371 GCCGGTCTCCCTTGGAGAGCTGG - Exonic
1147198565 17:38784007-38784029 GTTCCTCTCCCTCAGAGGGAGGG - Intronic
1148556469 17:48581706-48581728 GTTCCTCTCTCTTGGGGTGCTGG - Intronic
1148625166 17:49063785-49063807 TTTCCTGCCCCTTGCAGAGCAGG + Intergenic
1149584994 17:57780455-57780477 CTCCCTCTCTCTTGAAGAGCTGG - Intergenic
1149867402 17:60158320-60158342 GTTTCTCCTCCTTGGGGAGCAGG - Exonic
1150894497 17:69195679-69195701 GGTCCTCTGCCTAGGAAAGCCGG - Intronic
1151546697 17:74797713-74797735 CTTCCCCTCCCTTGGTGAGTTGG + Intronic
1152101357 17:78303673-78303695 GTTTCTCTCCCTTCCAGGGCCGG + Intergenic
1152318459 17:79594594-79594616 GTTCCTGTCCCTGGGACTGCAGG + Intergenic
1152419190 17:80182924-80182946 GTTCCTCACCCTCAGAGTGCTGG - Intronic
1154070186 18:11146802-11146824 GCTGCTGTCCCTTGGAGAGCGGG + Intronic
1155421619 18:25662720-25662742 GTTTTTTTCCTTTGGAGAGCTGG + Intergenic
1161812249 19:6477440-6477462 GTTCCTCTGCCTCGGTGACCTGG + Exonic
1164617803 19:29677183-29677205 GTCCCTCTCCCCTGCAGGGCTGG + Intergenic
1165855569 19:38877858-38877880 GTGCCTCTGCCCTGGAGAGAGGG + Intronic
1166144613 19:40825366-40825388 CTTTCTTTCCCTGGGAGAGCTGG + Intronic
1166183130 19:41122695-41122717 CTTTCTTTCCCTGGGAGAGCTGG - Intronic
1167241665 19:48347324-48347346 ATTCCTCCCACTTGGAGAACCGG - Intronic
925913341 2:8587391-8587413 GTTCCTCTCCCCTGCAGGCCTGG - Intergenic
925977676 2:9152354-9152376 TTTCCTTACCCTTGGGGAGCTGG - Intergenic
926885703 2:17596529-17596551 GGTCCTCTACCTTGGAGAGTTGG + Intronic
926971052 2:18467889-18467911 GTTCCTCTCTCATAGAGAGAGGG - Intergenic
927510409 2:23640872-23640894 GTGGCTCTCCCTTGGACAGTGGG + Intronic
927647519 2:24887415-24887437 GCTCCTTTCCCTCGGAGACCAGG + Intronic
929318912 2:40515919-40515941 GGTCCTCTGCCTTGGATAACTGG - Intronic
932063754 2:68531462-68531484 GTTCCTCTCTCTGGGAGAGAGGG - Intronic
932506391 2:72236141-72236163 GTTCCTCTCCTTACTAGAGCAGG + Intronic
932570685 2:72936860-72936882 GCTCCTCCCACCTGGAGAGCGGG + Intergenic
932909123 2:75787231-75787253 CATCCTCTTCCTTGGAGAGGAGG - Intergenic
933473884 2:82764390-82764412 TTTCCTTTCCCTTGAAGAGGTGG + Intergenic
933689966 2:85172248-85172270 CCTCCTCTCCCTTGGAGAGAAGG + Intronic
934676765 2:96254798-96254820 GTTCCTCTCCCACTGTGAGCAGG + Intronic
936111782 2:109670917-109670939 GTTCCTGTGGCTTGGGGAGCTGG + Intergenic
937099070 2:119254740-119254762 CTACCTCTCCCTGGGAGTGCTGG + Exonic
937477533 2:122228623-122228645 GTTTCTCTCCCTTGGCTATCAGG - Intergenic
938105578 2:128527785-128527807 GCTGCTCTGCCTGGGAGAGCAGG + Intergenic
938936073 2:136128639-136128661 GTTCTTCTCCCTTGCAAATCTGG + Intergenic
940598456 2:155825870-155825892 TTTCCTCTCCATTCTAGAGCTGG + Intergenic
940812869 2:158265611-158265633 GTACATCTCCCTTGGCTAGCTGG + Intronic
943280092 2:185921228-185921250 GATCCTCTCCCCTGGAGAGTAGG + Intergenic
944087790 2:195869437-195869459 GTTCATCTCCCTCAGATAGCAGG - Intronic
945221144 2:207485510-207485532 GTTCCTCTCTCTGGCAGACCTGG - Intergenic
945528534 2:210921072-210921094 GTTCCTTTCCCATGGATAGAGGG - Intergenic
945895350 2:215474833-215474855 GGTCCTCTCCTTTTGACAGCTGG - Intergenic
1168935100 20:1658187-1658209 GTTCCTCTCCAGTGTTGAGCAGG - Intergenic
1171417974 20:24996310-24996332 GTTGCCCTCCCCTGGAGAGCTGG + Intergenic
1172009986 20:31841139-31841161 GACCCTCTCCCTTGGAGGGCAGG - Intergenic
1173248713 20:41353379-41353401 CTTCGTCTTCCTTTGAGAGCAGG - Intronic
1173767999 20:45631392-45631414 GTTCCTCCCCCTGGGAGTACTGG - Intergenic
1173773552 20:45684433-45684455 GTTCCTCCCCCTGGGAGTACTGG + Intergenic
1173811203 20:45957048-45957070 TTCCCTCTGCCTTGGAGACCAGG + Intronic
1174461685 20:50687506-50687528 CTCACTTTCCCTTGGAGAGCTGG - Intronic
1175368083 20:58469017-58469039 GTTGCTCTCTCTGGGAGAACAGG - Intronic
1175745059 20:61450785-61450807 GACTCTCTCCATTGGAGAGCAGG - Intronic
1176091288 20:63319678-63319700 ACTCCTCTCCCTAGGAGAGCAGG + Intronic
1176717752 21:10367901-10367923 GTTCTGCCCACTTGGAGAGCAGG - Intergenic
1178585836 21:33869801-33869823 GTTCCTCTCGGTGGCAGAGCTGG + Intronic
1179186027 21:39085847-39085869 CTTCTTCACCTTTGGAGAGCAGG - Intergenic
1179633880 21:42695158-42695180 CTTCCACTCCCTTTTAGAGCTGG + Intronic
1180298979 22:11020807-11020829 GTTCTGCCCACTTGGAGAGCAGG - Intergenic
1181849445 22:25739644-25739666 GTTCCTTTCCCCTGGAGATTTGG - Intergenic
1182697931 22:32208821-32208843 CCTCTTCTCCCTTGGAGACCAGG - Intergenic
1183806850 22:40219146-40219168 GTTCCTCTCCCTGGGAGACCGGG + Intronic
1184493147 22:44821903-44821925 GTTCCTCTCCTTAGAAGAGGTGG + Intronic
1184967282 22:47988911-47988933 GTTCCTCTCCCTCAGATACCAGG + Intergenic
950555721 3:13694851-13694873 GTTCCTGTCCCTCCTAGAGCAGG - Intergenic
950973620 3:17216075-17216097 TTACCTCTCCCTTGGATAGAAGG + Intronic
951851019 3:27139928-27139950 GTTGCTCTCCTTTGGAGGCCAGG + Intronic
952899381 3:38099567-38099589 GTGCATCTCCCTTGGAGCTCTGG - Intronic
953821417 3:46210493-46210515 GTTCCTCTTCCTTGGAGAGAAGG + Intronic
954867975 3:53745719-53745741 GTTCCTCTACCTTGAACAACTGG - Exonic
955370263 3:58345154-58345176 GCCCCTCTGCCTGGGAGAGCAGG + Intronic
955780136 3:62475923-62475945 GTTCATAGCCCTTGGAGTGCAGG + Intronic
955787301 3:62553992-62554014 ATTCCTTTCCCCTAGAGAGCTGG - Intronic
957061091 3:75481908-75481930 TCTCCTCTCCCTTGGAGTGTAGG + Intergenic
957579123 3:82047831-82047853 TCTCCACTCCCTTGGAGAGCAGG + Intergenic
960252852 3:115475784-115475806 GTTTCTGTCCTCTGGAGAGCTGG - Intergenic
961292294 3:125857508-125857530 TCTCCTCTCCCTTGGAGTGTAGG - Intergenic
962430426 3:135313703-135313725 GCCCCTCTCCCCAGGAGAGCTGG + Intergenic
964845119 3:161037121-161037143 ATTCTTCTCCCTTTGAGTGCAGG + Intronic
965517622 3:169638491-169638513 GTTCCTCTCTCTGGAAAAGCAGG - Intronic
966598165 3:181746531-181746553 ATTTCTCTTTCTTGGAGAGCTGG - Intergenic
970429976 4:15980144-15980166 GTTCCTCTCTCTCGGGGACCTGG - Intronic
971701027 4:29976665-29976687 GTTCCTTTTCCTTGGACAACAGG + Intergenic
976589809 4:86837880-86837902 CTCCCTCTCCTTTGTAGAGCAGG - Intronic
976748202 4:88427151-88427173 TTATCTCTCCTTTGGAGAGCAGG - Intronic
976954587 4:90880146-90880168 GTTCCTCTCCCATTGAGTGCTGG + Intronic
977005872 4:91569265-91569287 GTTCCTCTCCCCTTGAGTGCTGG + Intronic
982659898 4:158194017-158194039 TTTCTTTTCCCTTGGAGGGCTGG - Intergenic
983313284 4:166093733-166093755 GGACCTCTGCCTTGGAAAGCCGG - Intronic
984598829 4:181703594-181703616 TTTCCTCTGCTTTGGGGAGCAGG - Intergenic
984630315 4:182053679-182053701 GTTCCCCTGCCTTAAAGAGCAGG - Intergenic
988377333 5:30454202-30454224 TTGCCTCTTCCTTGTAGAGCTGG - Intergenic
990327863 5:54696012-54696034 GTCCCTGGCCCTTGGAGATCTGG + Intergenic
997385441 5:133468536-133468558 GCTCCTCTGCCTTAGAGGGCAGG - Intronic
997880275 5:137583057-137583079 GAACCTCTCCCTTGGACAGAGGG - Intronic
998903372 5:146878494-146878516 CCTCCTCCCCCTGGGAGAGCGGG + Intronic
999047780 5:148487834-148487856 ATTCCTTTCCCTTTGGGAGCAGG - Intronic
999074597 5:148781950-148781972 GTTCCTCTCCCCTTGAGTTCTGG - Intergenic
999315677 5:150582476-150582498 GTTCCTGGCCTTTGGGGAGCTGG + Intergenic
1003613392 6:7633005-7633027 GTGACTCTCCCCTGGAGAGAGGG - Intergenic
1004172137 6:13303422-13303444 CTTCCTCGCCCTTGGAAAGCTGG - Intronic
1006428203 6:33979204-33979226 GCTCCCCTGCCTTGGGGAGCAGG + Intergenic
1006745212 6:36336832-36336854 CATCTTCTCCCTGGGAGAGCTGG - Exonic
1010274748 6:73956519-73956541 GCTCCTCTCCCTTGGGGTGGAGG - Intergenic
1011392416 6:86868213-86868235 GATCCTCTCCCCTTGAGTGCTGG - Intergenic
1013627039 6:111948924-111948946 GACCCTCTCCCTTGGGGAGGAGG + Intergenic
1016065230 6:139675662-139675684 ATTCCTCTCACCTGGAGAGTAGG - Intergenic
1016815028 6:148295505-148295527 CTTCTTCTCCCTTGGAGAGGGGG + Intronic
1018905350 6:168072485-168072507 GTTTCTCGCCTTGGGAGAGCAGG + Intronic
1019782982 7:2955317-2955339 GTTCCCCCTCCTTAGAGAGCTGG + Intronic
1022032943 7:26508590-26508612 GTCCCTCTGCCTAGGAAAGCAGG - Intergenic
1024847100 7:53659297-53659319 GTTCATCTGCTTTGGAAAGCTGG + Intergenic
1027883219 7:83869890-83869912 TTTCCTCTACCTGGGAGAACTGG + Intergenic
1028274851 7:88842347-88842369 GTTCCACTTCATGGGAGAGCTGG - Intronic
1032594905 7:133229632-133229654 TGAGCTCTCCCTTGGAGAGCAGG - Intergenic
1034522953 7:151634590-151634612 TTTGCTATTCCTTGGAGAGCAGG - Intronic
1035899352 8:3441183-3441205 GTTTCTCTCCCCGGGAGATCTGG + Intronic
1036090866 8:5663913-5663935 CTTTCTCTCCCTTGGACTGCTGG - Intergenic
1036091036 8:5665491-5665513 CTTTCTCTCCCTTGGACTGCTGG - Intergenic
1036413064 8:8520319-8520341 ATTCCTCTTCCTTGGAGCCCAGG + Intergenic
1036544973 8:9759157-9759179 GCTCCCCTCCCCTGGAGTGCAGG - Intronic
1036776518 8:11616675-11616697 GGCACTCTTCCTTGGAGAGCTGG - Intergenic
1037613962 8:20500491-20500513 GTTCCTCTCCCTTTTAGGGAGGG - Intergenic
1038746357 8:30258565-30258587 GTTCCTCTGCCAGGGAGAGATGG - Intergenic
1041635615 8:60139178-60139200 TTTCCTATCCCTTGGAGAGTTGG - Intergenic
1045481521 8:102596715-102596737 CTTGGCCTCCCTTGGAGAGCGGG + Intergenic
1045835267 8:106513233-106513255 TTTCCTGCTCCTTGGAGAGCTGG + Intronic
1047417133 8:124673948-124673970 GGTCCTCTTCCTCAGAGAGCAGG + Intronic
1047967635 8:130058192-130058214 TTTCCTCACCCTTGAAGGGCGGG + Intronic
1055068043 9:72138385-72138407 GTTCTGCTCCCTGAGAGAGCAGG - Intronic
1056104078 9:83329723-83329745 ATTCCTTGCCCTTGAAGAGCAGG - Intronic
1056913490 9:90725083-90725105 GTTCCTCTCTGTTGAGGAGCGGG + Intergenic
1056943976 9:90978027-90978049 GCTCTTCTCCCAAGGAGAGCTGG - Intergenic
1061643136 9:131975875-131975897 GTTCCTCTCCCTTGGAGAGCTGG - Intronic
1062029596 9:134356208-134356230 GTTCCCCTCCCTTGCAGGGCTGG - Intronic
1062413524 9:136436548-136436570 GTTCCTTTTGCTCGGAGAGCTGG - Intronic
1062664776 9:137663808-137663830 GATCCTCTCACCTGGAGAGAAGG + Intronic
1186513944 X:10152052-10152074 ATGCCCCACCCTTGGAGAGCTGG + Intergenic
1188967161 X:36568554-36568576 GTTCCTGTCCCTCCTAGAGCAGG - Intergenic
1191782746 X:64886052-64886074 GTTCTTCTCCCCTGCAGAGCTGG + Intergenic
1192050631 X:67721004-67721026 GTTGCTCTTCCTTGAAAAGCTGG + Intronic
1192412595 X:70947588-70947610 TTTTCTCTCCCTTTGAGAGCAGG + Intergenic
1193575120 X:83186400-83186422 GGTCCTGTACCTTGGAGGGCAGG + Intergenic
1195538638 X:106037221-106037243 GTTTCTCTCCCTTGAAAAACAGG + Exonic
1196108037 X:111917111-111917133 TTTCCTCCCCTGTGGAGAGCTGG - Intronic
1196160780 X:112479968-112479990 GCTGCTCTCCCTTGCAGAGCTGG - Intergenic
1199268643 X:145857129-145857151 GCTCCTCTCTCTTGGACAGGGGG + Intergenic
1200390490 X:155940390-155940412 GGTCCTCTGCCTTAGACAGCTGG + Intronic
1201795200 Y:17889661-17889683 GTTCATCTCACTGGGAGTGCTGG + Intergenic
1201806355 Y:18016323-18016345 GTTCATCTCACTGGGAGTGCTGG - Intergenic