ID: 1061643526

View in Genome Browser
Species Human (GRCh38)
Location 9:131979744-131979766
Sequence AAGGAATATTTTGGCATAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 741
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 711}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061643526_1061643534 27 Left 1061643526 9:131979744-131979766 CCACTTATGCCAAAATATTCCTT 0: 1
1: 0
2: 3
3: 26
4: 711
Right 1061643534 9:131979794-131979816 CATGCTAACTCCTTGTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061643526 Original CRISPR AAGGAATATTTTGGCATAAG TGG (reversed) Intronic
902051460 1:13566922-13566944 AAGAAAGATTTTGGGGTAAGGGG - Intergenic
903395399 1:22998081-22998103 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
904394353 1:30208538-30208560 AAGAAAGATTTTGGGGTAAGGGG - Intergenic
904712023 1:32437446-32437468 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
905500171 1:38430177-38430199 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
906081313 1:43090582-43090604 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
906379323 1:45322176-45322198 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
906550947 1:46666167-46666189 AAGGAATTTTATGGAAGAAGGGG - Intronic
906744121 1:48209582-48209604 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
906751374 1:48265030-48265052 AAGGATGATTTTGTCAGAAGAGG - Intergenic
907503182 1:54898469-54898491 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
908211304 1:61903155-61903177 AAGGAGTATTCTGGCTTCAGGGG + Intronic
908315564 1:62928637-62928659 GATGAATATTTTGGGAGAAGGGG + Intergenic
909015255 1:70373400-70373422 AAGGAAGATTTTGTGGTAAGGGG - Intronic
909035861 1:70593397-70593419 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
909160549 1:72143338-72143360 AAGGAATATTTGGGCATGACTGG - Intronic
909538832 1:76768356-76768378 AAGGGCTATATTGGCATTAGTGG + Intergenic
909550638 1:76895391-76895413 AAGGAAGATTTTGTGGTAAGGGG + Intronic
909787874 1:79639335-79639357 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
909792582 1:79696941-79696963 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
909926775 1:81446819-81446841 AATTGATATTTTGACATAAGTGG + Intronic
910049854 1:82960993-82961015 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
910393405 1:86767698-86767720 AAGGAATATTTCTGTATAGGAGG + Intergenic
911460217 1:98180271-98180293 AATGATTATTTTGGGATAAGGGG + Intergenic
911759262 1:101597797-101597819 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
912296849 1:108478041-108478063 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
912814026 1:112814799-112814821 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
912814839 1:112820703-112820725 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
912939405 1:114031893-114031915 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
913095172 1:115509713-115509735 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
913245641 1:116867853-116867875 AAGGAAGATTTTGTTGTAAGGGG - Intergenic
913259282 1:116983943-116983965 AAAGAAGACTTTGGCACAAGTGG - Intronic
913477615 1:119253381-119253403 AAGTAATCTTTTGGCATGAATGG + Intergenic
913655570 1:120956511-120956533 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
915785917 1:158611836-158611858 GAGGAACTCTTTGGCATAAGAGG - Intronic
915955652 1:160218003-160218025 TAGGCCTCTTTTGGCATAAGAGG + Intronic
916329247 1:163595939-163595961 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
916942225 1:169688123-169688145 AAGGAAGATTTTGTGGTAAGGGG - Intronic
918645713 1:186902389-186902411 AAGAAAGATTTTGTGATAAGGGG - Intronic
918803090 1:188999015-188999037 AAGGACAATTTTGCCATATGTGG - Intergenic
919580127 1:199361287-199361309 TAGGATAATATTGGCATAAGAGG + Intergenic
920901142 1:210111614-210111636 AAGGAAGATTTTGTGGTAAGGGG + Intronic
921205620 1:212846191-212846213 AAGAAAGATTTTGGGGTAAGGGG - Intronic
921761793 1:218923527-218923549 AAGTATTAATTTGGCATATGTGG - Intergenic
922363067 1:224840496-224840518 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
922369255 1:224893059-224893081 AAGTAAGATTTTGGGGTAAGGGG - Intergenic
922687732 1:227658948-227658970 AAGATATATTTTTGCTTAAGGGG - Exonic
922935287 1:229418028-229418050 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
923321701 1:232840497-232840519 AATGAAGATTATGGAATAAGAGG - Intergenic
923963188 1:239106471-239106493 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
924895719 1:248336287-248336309 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1063363593 10:5476422-5476444 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1063891178 10:10630125-10630147 AAGGAAAATTATTGCATTAGAGG - Intergenic
1063996884 10:11628058-11628080 AAGGAAAATTTTGCCATAAAAGG - Intergenic
1064145744 10:12824690-12824712 AGGGAATATTATGGTGTAAGAGG + Intronic
1064886605 10:20119773-20119795 AAGGAAGATTTTGTGGTAAGGGG + Intronic
1065438118 10:25722325-25722347 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1065610950 10:27470295-27470317 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1066102990 10:32134257-32134279 AAGAAAAATTTTGGGGTAAGGGG + Intergenic
1066175315 10:32897447-32897469 ATGGAATATTTAGCCATAAAAGG + Intergenic
1066243546 10:33560884-33560906 AAGGCAAGTTTTGGCAGAAGTGG + Intergenic
1066436663 10:35402183-35402205 AAGAAAGATTTTGGGGTAAGGGG + Intronic
1067360703 10:45575520-45575542 AAGGAAGATTTTGTGGTAAGAGG - Intronic
1068052292 10:51965809-51965831 AAAGAATATTTTGTCAAAAATGG + Intronic
1068361409 10:55978331-55978353 AAGAAAGATTTTGGAGTAAGGGG - Intergenic
1068381550 10:56260197-56260219 GAGGAATATTATGACATAAATGG + Intergenic
1068484642 10:57642141-57642163 AGGGAATATTTTGTAATATGAGG + Intergenic
1068522684 10:58094644-58094666 AAGGAAGATTTTGCGGTAAGGGG + Intergenic
1068731998 10:60368579-60368601 CAGCAATTTTTTAGCATAAGTGG + Intronic
1068739732 10:60455364-60455386 GAAGAATATCTTGACATAAGAGG - Intronic
1069034926 10:63636515-63636537 TAGGGATATTTTGGCTTAAATGG - Intergenic
1069041141 10:63696705-63696727 ATGGAATATGTTGGGCTAAGAGG + Intergenic
1070893912 10:79965372-79965394 AAGGAAGATTTTGTGGTAAGGGG - Intronic
1071187723 10:83062795-83062817 AAGAAAGATTTTGGGGTAAGGGG - Intergenic
1071550382 10:86561859-86561881 AAGAAAGATTTTGGAGTAAGGGG + Intergenic
1071687148 10:87770855-87770877 AGGGAATATTTTGTCATATAGGG - Intronic
1071961528 10:90812616-90812638 AAGGAAGATTTTGTGGTAAGGGG - Intronic
1072010873 10:91301862-91301884 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1072350967 10:94556561-94556583 AAAGAATTTTTTGGAATCAGTGG - Intronic
1073014598 10:100387853-100387875 AAGAAAGATTTGGGTATAAGGGG - Intergenic
1074664747 10:115707988-115708010 AAGGAATATTTTTACCTAATTGG - Intronic
1074741200 10:116485918-116485940 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1075485132 10:122815509-122815531 AAGGAATCTTCTGGCAAAAGTGG - Intergenic
1077588212 11:3470824-3470846 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1077678660 11:4219907-4219929 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1077688067 11:4316310-4316332 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1077765988 11:5160877-5160899 AAGGAAGATTTTGTGGTAAGGGG + Intronic
1077883792 11:6371058-6371080 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1078789522 11:14528438-14528460 AAGAAAGATTTTGGGGTAAGGGG - Intronic
1078858634 11:15227087-15227109 TAAGAATATTTTGGCTCAAGAGG + Intronic
1078919130 11:15810629-15810651 AAGGAATATTATGACCTAATAGG + Intergenic
1079231010 11:18648852-18648874 AAGAAAGATTTTGGAGTAAGGGG - Intergenic
1079599253 11:22290946-22290968 TAGGAATATTATGGAATAAAGGG + Intergenic
1079726688 11:23887802-23887824 AAGGAAGATTTTGTGGTAAGAGG + Intergenic
1079750781 11:24193710-24193732 AAGAACGATTTTGTCATAAGGGG + Intergenic
1079847172 11:25487075-25487097 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1080173649 11:29336544-29336566 TAGGAATATTTTTCAATAAGGGG - Intergenic
1080203822 11:29706278-29706300 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1080450933 11:32378360-32378382 AGGGAATATCTTGGCATACCTGG - Intergenic
1081160237 11:39740442-39740464 AAGGAAGATTTTGTAGTAAGGGG - Intergenic
1082197231 11:49321119-49321141 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1082932855 11:58626969-58626991 AAGGAATATGTATGTATAAGAGG + Intergenic
1082952857 11:58836108-58836130 AAAAAATATGTTGGCATTAGTGG - Intronic
1083534927 11:63458865-63458887 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1084232693 11:67764763-67764785 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1084243909 11:67842467-67842489 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1084355947 11:68638800-68638822 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1084585337 11:70058037-70058059 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
1084612881 11:70214839-70214861 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1085262139 11:75212417-75212439 AAAGAATATTTGAGCTTAAGAGG - Intergenic
1085570610 11:77555080-77555102 AAGAAAGATTTTGGGGTAAGGGG - Intronic
1085934681 11:81126886-81126908 AAGGAAAATTTTGTGGTAAGGGG - Intergenic
1086005444 11:82030362-82030384 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1086036313 11:82419268-82419290 GAGGAATATTTTGGAGTAAAAGG - Intergenic
1086125167 11:83342561-83342583 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1086378039 11:86221469-86221491 AATTAATATTTTTGCATAAAAGG + Intergenic
1086550722 11:88049037-88049059 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1086723626 11:90152509-90152531 AAGGAGTATTTTTGCAAAATTGG - Intronic
1086881872 11:92159125-92159147 AAGGAAAATTTTGCCATAAAAGG + Intergenic
1087100060 11:94354947-94354969 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1087839110 11:102904488-102904510 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1089470663 11:118717612-118717634 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1089473855 11:118742725-118742747 AAGGAATATTATGACAGAAAAGG - Intergenic
1089866574 11:121637974-121637996 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1089988070 11:122832221-122832243 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1090107144 11:123865883-123865905 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1090546062 11:127769489-127769511 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1090926529 11:131255099-131255121 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1091184107 11:133632105-133632127 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1091666960 12:2425900-2425922 AAGTAATAATTTGGCAGGAGGGG + Intronic
1092255576 12:6925259-6925281 AAGAAAAATTTAGGCATATGTGG - Intronic
1092738934 12:11610360-11610382 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1092790101 12:12063491-12063513 AAGGAAGATTTTGTGGTAAGGGG - Intronic
1092924387 12:13260199-13260221 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1093024862 12:14236439-14236461 AAGTAAGATTTTGGGGTAAGGGG - Intergenic
1093321584 12:17720820-17720842 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1093579199 12:20768416-20768438 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1093812398 12:23506461-23506483 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1094252673 12:28382917-28382939 AAGGAATAATGTGGCATCTGAGG + Intronic
1094287465 12:28811496-28811518 ATGGCATATTTAGGGATAAGTGG - Intergenic
1094401183 12:30061864-30061886 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1094723416 12:33088451-33088473 AAGGAAGATTTTGCGGTAAGGGG + Intergenic
1095154638 12:38837562-38837584 AAATAATATTTAGGGATAAGAGG + Intronic
1095778762 12:46036411-46036433 AAGGAAGATTTTGTAGTAAGGGG - Intergenic
1096375575 12:51107386-51107408 AAGCAATATTTTGGGTTAAAAGG - Intronic
1096906727 12:54943098-54943120 AAGGAAGATTTTGTGTTAAGGGG + Intergenic
1096977769 12:55708995-55709017 AGGAAATAATTTGGCATAATGGG + Intronic
1097541689 12:60951841-60951863 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1097592831 12:61592365-61592387 AAGGAAGATTTTGTGGTAAGAGG - Intergenic
1097770663 12:63580992-63581014 AACGAATATATTGGCATTACAGG + Intronic
1098137978 12:67422897-67422919 AAGAAAGATTTTTGCATCAGGGG + Intergenic
1098406478 12:70131857-70131879 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1098629587 12:72709291-72709313 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1098639943 12:72826195-72826217 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1098920391 12:76297180-76297202 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1099291695 12:80783687-80783709 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1099382785 12:81975779-81975801 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1099835676 12:87907856-87907878 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1100561751 12:95754266-95754288 AAGGAAGATTTTGTGGTAAGGGG - Intronic
1100940808 12:99721138-99721160 AAGGAAGATTTTGTGGTAAGGGG - Intronic
1101694538 12:107112759-107112781 ATGGAATAATTTTGCATAACTGG - Intergenic
1102366664 12:112342757-112342779 ATGGCATAATTTGGCATACGTGG - Intronic
1106926049 13:34614293-34614315 AAGGAATATAGGGGCAGAAGAGG + Intergenic
1107018381 13:35727443-35727465 AAGAAAAATTTTGGCAGGAGAGG + Intergenic
1107219860 13:37969578-37969600 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1107293294 13:38881797-38881819 AAGGAACATTTTGACAGATGAGG + Exonic
1107497445 13:40941336-40941358 AAGGGGTATTCTGGCAAAAGTGG - Exonic
1107654707 13:42579541-42579563 AAGGAATAATGTGGCCTTAGTGG - Intronic
1108203138 13:48061692-48061714 AAGGAAGATTTTGTGGTAAGGGG - Intronic
1108281577 13:48867260-48867282 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
1108803444 13:54127985-54128007 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1108989710 13:56639731-56639753 AAAGAATATTTTGCCAAAAGTGG - Intergenic
1109040249 13:57325252-57325274 AAAGTATATTTTGGCAGATGTGG + Intergenic
1109344021 13:61093836-61093858 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1109353397 13:61210685-61210707 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1109499743 13:63218526-63218548 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1109696651 13:65969532-65969554 TAAAAATATTTTGGCATGAGTGG - Intergenic
1110241040 13:73267186-73267208 AATGAGCATTTAGGCATAAGTGG + Intergenic
1110765879 13:79279219-79279241 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1110845808 13:80189338-80189360 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1110978944 13:81871842-81871864 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1111125641 13:83908900-83908922 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1111361705 13:87187026-87187048 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1111378937 13:87420145-87420167 ATGGAATAGTTTGAAATAAGTGG + Intergenic
1111547197 13:89755917-89755939 GAGCAATATCCTGGCATAAGAGG - Intergenic
1111630827 13:90844516-90844538 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1112169241 13:96952417-96952439 ATGGAATATTAAAGCATAAGGGG - Intergenic
1112888881 13:104208167-104208189 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1114234912 14:20815118-20815140 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
1114600245 14:23950433-23950455 AAAGAGTATTTTGGAAGAAGGGG + Intergenic
1114770621 14:25426115-25426137 AAGAAATATTTTGGGGTAAAGGG + Intergenic
1114928775 14:27440278-27440300 AAGAAATATTTTGATATCAGAGG + Intergenic
1115569642 14:34654578-34654600 AAGAAAGATTTTGGGGTAAGGGG - Intergenic
1116215588 14:42013002-42013024 AAGGAAACTTTTGACAAAAGGGG - Intergenic
1116408125 14:44591140-44591162 AAGGAATAGTTTGAGATATGTGG - Intergenic
1116701968 14:48255775-48255797 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1116702909 14:48262972-48262994 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1117439409 14:55745892-55745914 CAGGAGTATTTTGCCAGAAGTGG - Intergenic
1117957484 14:61133813-61133835 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1119022805 14:71129407-71129429 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1119247945 14:73128991-73129013 AAGGAAGATTTTGGGGTAAGGGG + Intergenic
1120130712 14:80803535-80803557 TAGGCATACTTTGGCATGAGTGG - Intronic
1120250958 14:82061482-82061504 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1120618635 14:86736460-86736482 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1120731161 14:88002835-88002857 AAGGAAATTTCTGGCACAAGCGG - Intergenic
1120909002 14:89648354-89648376 TAGGACTAATTTGGCATAAGGGG + Intergenic
1121057301 14:90868472-90868494 AACAATTATTTTGACATAAGTGG + Exonic
1122508131 14:102245209-102245231 AAGGAAGATTTTGGGGTAATGGG - Intronic
1202875741 14_GL000225v1_random:208492-208514 AAGGAATAGATGGTCATAAGAGG + Intergenic
1202878225 14_KI270722v1_random:29708-29730 AAGGAATAGATGGTCATAAGAGG + Intergenic
1123882069 15:24685920-24685942 AAGGAAGATTTTGCGGTAAGGGG + Intergenic
1126529677 15:49699098-49699120 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1127724799 15:61738896-61738918 AAGGAATATTTTCTTCTAAGTGG + Intergenic
1129259857 15:74359197-74359219 AAGGAAGATTTTGTGGTAAGGGG - Intronic
1130781512 15:87044921-87044943 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1131165254 15:90137722-90137744 AAGAAAGATTTTGGGGTAAGGGG - Intergenic
1131448168 15:92516826-92516848 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1131563940 15:93468512-93468534 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
1131684585 15:94755868-94755890 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1131685154 15:94759773-94759795 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1132059253 15:98678012-98678034 AAGGCATCTTTTGGTTTAAGAGG + Intronic
1132263458 15:100445609-100445631 AAGGAAGATTTTGTGGTAAGGGG - Intronic
1133939235 16:10294644-10294666 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1136530380 16:30864476-30864498 AAGAAAGATTTTGGGGTAAGGGG - Intronic
1137363943 16:47844385-47844407 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1138908385 16:61366336-61366358 AAGGAGGGTTTTGGAATAAGAGG - Intergenic
1139130466 16:64136653-64136675 GAGGAACATTTTGATATAAGTGG + Intergenic
1139942654 16:70617082-70617104 AAGGAAGATTTTGTGGTAAGGGG + Intronic
1141418782 16:83898658-83898680 AAGGAATATGCTTGCTTAAGAGG - Intergenic
1143044160 17:4063337-4063359 AAGGAATCTTTCTGCATCAGAGG - Intronic
1143670951 17:8395594-8395616 AAGGAACATTTGGGGATGAGAGG - Intronic
1145080273 17:19889052-19889074 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
1146340667 17:32017082-32017104 AAGGGATACCTTTGCATAAGAGG - Intronic
1148464152 17:47854921-47854943 AAGGAATATGTTGGCATCCAGGG - Intronic
1149221124 17:54416205-54416227 AAGAAAGATTTTGGGGTAAGAGG - Intergenic
1149320418 17:55475887-55475909 AAGAAAGATTTTGGGGTAAGGGG - Intergenic
1150039120 17:61839741-61839763 ATGGAATAATTTTTCATAAGTGG - Intronic
1151503179 17:74505842-74505864 AAGAAAGATTTTGGGGTAAGGGG - Intergenic
1151839357 17:76606568-76606590 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1153290392 18:3495981-3496003 AAAGCATATTTTGGAAGAAGTGG + Intergenic
1153316801 18:3730443-3730465 CAGGAATATTTTTTCTTAAGTGG - Intronic
1155174300 18:23289460-23289482 AAGGAAGATTTTGTGGTAAGGGG - Intronic
1155892277 18:31284769-31284791 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1155942018 18:31809464-31809486 AAGGAAGATTTTGTGGTAAGCGG - Intergenic
1156120891 18:33841508-33841530 AAAGAATTGTTTGGCATCAGGGG + Intergenic
1156251504 18:35356721-35356743 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1156747418 18:40409252-40409274 AAGAAATATTTTTTCATAATAGG + Intergenic
1156916542 18:42469133-42469155 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1156938922 18:42741753-42741775 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1157760798 18:50263795-50263817 GAGGGATATTTTGGCTGAAGAGG + Intronic
1157905993 18:51570642-51570664 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1158117566 18:54013300-54013322 AAGTAAGATTTTGGGGTAAGGGG - Intergenic
1158575754 18:58636426-58636448 AAAGAATATTTTGGGATGATGGG + Intergenic
1158576334 18:58641744-58641766 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1158831583 18:61285268-61285290 ATGGAATCTTTTGGCACAACCGG - Intergenic
1159164886 18:64686730-64686752 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1159848937 18:73502733-73502755 AAGGAATATTCTGCCATATCCGG + Intergenic
1159929764 18:74298496-74298518 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1160161621 18:76477025-76477047 AACGAATATTTCTGCATAAAGGG - Intronic
1160424373 18:78770167-78770189 AAGGAATATTTTGTTGGAAGAGG + Intergenic
1161711259 19:5849586-5849608 AAGGAAGATTTTGGGGTAAGGGG - Intronic
1162287606 19:9751226-9751248 AAGTAAGATTTTGGGGTAAGGGG - Intergenic
1164202034 19:23026973-23026995 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1164459004 19:28431791-28431813 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1166180913 19:41108097-41108119 AAGGTATATTTTAGCCTTAGTGG - Intergenic
1166905145 19:46102920-46102942 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
1167046215 19:47050448-47050470 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1167099863 19:47398123-47398145 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1167902540 19:52632854-52632876 AAGGAAGATTTTGTGGTAAGGGG - Intronic
1167917793 19:52756274-52756296 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1168211639 19:54894879-54894901 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1168227591 19:55007407-55007429 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1168248796 19:55128968-55128990 AAGAAAGATTTTGGGGTAAGGGG - Intergenic
1202672452 1_KI270710v1_random:3218-3240 AAGGAATAGATGGTCATAAGAGG - Intergenic
925433392 2:3816102-3816124 AAGGAAGATTTTGTGGTAAGGGG + Intronic
925767719 2:7252999-7253021 AAGGAATGTTTTGGCACTAAAGG + Intergenic
926440887 2:12887382-12887404 AAAGAATATTATAACATAAGTGG + Intergenic
927134591 2:20087510-20087532 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
927286387 2:21361373-21361395 AGGAAACATTTAGGCATAAGTGG - Intergenic
928770337 2:34697043-34697065 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
928778792 2:34795457-34795479 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
928779312 2:34801577-34801599 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
928827234 2:35437495-35437517 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
928857579 2:35818182-35818204 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
929004427 2:37381590-37381612 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
929076278 2:38081370-38081392 AAGGAAGATTTTGTGGTAAGGGG + Intronic
929652035 2:43689699-43689721 AAGAAAAATATTGGCAAAAGGGG - Intronic
929792669 2:45035059-45035081 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
930098238 2:47583343-47583365 AAGAAAGATTTTGGGATAAGGGG + Intergenic
930634693 2:53791181-53791203 AAAAAATATCTTGGCATGAGAGG - Intronic
930706218 2:54507459-54507481 AAGGAAGATTTTGTGGTAAGGGG + Intronic
930958876 2:57234655-57234677 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
931043010 2:58318805-58318827 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
931237226 2:60421832-60421854 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
931948670 2:67336963-67336985 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
932158969 2:69443577-69443599 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
933164110 2:79056482-79056504 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
933179324 2:79211927-79211949 AAGGAAGATTTTGTGGTAAGGGG + Intronic
933276909 2:80293795-80293817 AGGGAATATTTTGGTGTTAGGGG + Intronic
933502783 2:83136713-83136735 AAAGAATATTTTTGTAAAAGTGG - Intergenic
933552011 2:83789527-83789549 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
935346884 2:102116445-102116467 AAGTGAGATTTTGGCATAAATGG + Intronic
936107191 2:109634894-109634916 AAGGAATATTTAATCATAAAGGG - Intergenic
936793842 2:116184334-116184356 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
936871047 2:117134517-117134539 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
938251983 2:129822483-129822505 ATGGAACACTATGGCATAAGTGG - Intergenic
938578335 2:132623846-132623868 AAGGAAGATTTTGGAATGATGGG + Intronic
939307878 2:140431800-140431822 AAGGAAGATTTTGTGGTAAGGGG - Intronic
939517950 2:143192595-143192617 GAGGAATAGATTGGCATAGGAGG - Intronic
940107791 2:150117919-150117941 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
940113983 2:150187252-150187274 AAGGTATTGTTTGGCTTAAGAGG - Intergenic
940183550 2:150959546-150959568 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
940232700 2:151474070-151474092 CAGGTATATTTTAGCAAAAGTGG + Exonic
940508282 2:154583217-154583239 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
941544936 2:166837313-166837335 ACGAAATATTTTGGGAGAAGAGG + Intergenic
941751101 2:169136197-169136219 AAGGAAGATTTTGTGGTAAGGGG - Intronic
941919760 2:170838676-170838698 TAGGAATATCTGGTCATAAGTGG - Intronic
941935453 2:170978029-170978051 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
942860094 2:180598901-180598923 AAGAAATATTTGGGGATATGTGG + Intergenic
943017941 2:182537190-182537212 AAGGAATATTGAGGGATAGGAGG + Intergenic
943228982 2:185220940-185220962 AAGAGATATTTTGACATAAATGG + Intergenic
943381944 2:187160893-187160915 ATGGAATATTTTATCAAAAGTGG - Intergenic
943421189 2:187671096-187671118 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
943450583 2:188038536-188038558 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
943460720 2:188169269-188169291 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
943738062 2:191378827-191378849 AAGAAAGATTTTGGGATAAGGGG + Intronic
943760714 2:191605676-191605698 AAGGGACATTTTGGGATAACTGG - Intergenic
943950878 2:194131283-194131305 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
944387903 2:199185037-199185059 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
944485680 2:200202421-200202443 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
944875716 2:203962521-203962543 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
945025930 2:205620002-205620024 AAATCATATTTTGGCATATGGGG + Intronic
945173892 2:207022681-207022703 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
945301035 2:208216509-208216531 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
945376564 2:209083735-209083757 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
945858623 2:215095475-215095497 AAGAAAGATTTTGGGGTAAGAGG - Intronic
946079224 2:217102745-217102767 AGGGAATATTTTGGCAGAAGAGG - Intergenic
946886899 2:224230395-224230417 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
946893671 2:224301761-224301783 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
947782264 2:232778948-232778970 AAGGAATTTTTTGAGATAAGGGG + Intronic
947842321 2:233215714-233215736 AAGAAAGATTTTGGGGTAAGGGG + Intronic
1168739821 20:178209-178231 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1168820430 20:769269-769291 CAGGAATATTTTGGAAGAAGTGG + Intergenic
1168942812 20:1727822-1727844 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1169462592 20:5809077-5809099 AAAGAATAATTTCTCATAAGAGG + Intronic
1169512544 20:6279641-6279663 AAGGGGTATTTAAGCATAAGAGG - Intergenic
1170227238 20:14004929-14004951 CAGGAATATTTAGGCAAAAATGG - Intronic
1170632986 20:18081074-18081096 AAGGAATATGTTAGCATCTGAGG - Intergenic
1170679966 20:18517720-18517742 AAGAAAGATTTTGGCGTAAGGGG + Intronic
1170820412 20:19752647-19752669 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1173312263 20:41907515-41907537 ATGTAATATTTTGGCCAAAGTGG - Intergenic
1173652553 20:44676117-44676139 AAGAAAGATTTTGGGGTAAGGGG - Intergenic
1173763382 20:45584824-45584846 AAGGAAGATTTTGCGGTAAGGGG + Intergenic
1173782101 20:45764642-45764664 AAGGAAGATTTTGTGGTAAGGGG - Intronic
1174898453 20:54475136-54475158 AAGGAAGCATTTGGCTTAAGCGG + Intergenic
1175051519 20:56159887-56159909 AAGGACTATTTTGGGGTAAAGGG + Intergenic
1176639529 21:9287173-9287195 AAGGAATAGATGGTCATAAGAGG + Intergenic
1177030735 21:15980231-15980253 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1177062484 21:16392725-16392747 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
1177103112 21:16919304-16919326 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1177120045 21:17127154-17127176 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1177668775 21:24197049-24197071 AAGAAATATTATAGCATAAATGG - Intergenic
1177840314 21:26228447-26228469 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1178001602 21:28166305-28166327 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1179518444 21:41926055-41926077 AAGCAATTATTTGGCATAGGCGG + Intronic
1180348543 22:11776548-11776570 AAGGAATAGATGGTCATAAGAGG + Intergenic
1180372830 22:12060002-12060024 AAGGAATAGATGGTCATAAGAGG + Intergenic
1180389654 22:12215663-12215685 AAGGAATAGATGGTCATAAGAGG - Intergenic
1180416282 22:12718819-12718841 AAGGAATAGATGGTCATAAGAGG + Intergenic
1180423574 22:12894641-12894663 AAGGAATAGATGGTCATAAGAGG + Intergenic
1181928340 22:26378373-26378395 AAAGAATAATTTGGCCAAAGTGG + Intronic
1185131281 22:49040528-49040550 AAAGAATATTTGTGAATAAGTGG - Intergenic
949161696 3:891275-891297 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
950765007 3:15267019-15267041 AAGTAATACTTTGGAAGAAGAGG + Intronic
951101049 3:18689430-18689452 AAAAAAGATATTGGCATAAGTGG - Intergenic
951118534 3:18894941-18894963 ATGCAATATTTTGGTAGAAGGGG - Intergenic
951315892 3:21189592-21189614 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
951511392 3:23506643-23506665 AAGGAATCTTTCAGCATATGGGG - Intronic
951888761 3:27550171-27550193 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
951895066 3:27602508-27602530 AAGGGAGATTTTGGGGTAAGGGG - Intergenic
952343126 3:32461523-32461545 AAGGAAGATTTTGTGGTAAGGGG + Intronic
952663070 3:35874933-35874955 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
952792255 3:37209325-37209347 AAGAAATATTTTGGGGTAAGGGG - Intergenic
953076741 3:39578411-39578433 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
953177584 3:40566080-40566102 AAGGAAGATTTTGTGGTAAGGGG - Intronic
956232999 3:67038466-67038488 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
956548557 3:70435253-70435275 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
956709662 3:72028302-72028324 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
957734316 3:84187402-84187424 AAGGAAGATTTTGTGGTAAGAGG + Intergenic
957745089 3:84330288-84330310 AATAAATATTTTGGCTTTAGAGG - Intergenic
957750720 3:84411497-84411519 AAGGTAAATTTTTGCCTAAGGGG + Intergenic
957904288 3:86537672-86537694 AAGGAAGATTTTGTGGTAAGAGG + Intergenic
958422442 3:93943490-93943512 AAGGAAGATTTTGTGGTAAGGGG - Intronic
958730483 3:97955364-97955386 ATGGAATATTTTGGCCTGAGTGG - Intronic
958751418 3:98196236-98196258 AAGGAAGATTTTGTGGTAAGGGG - Intronic
958755928 3:98249202-98249224 AAGTAATACTTTGGGGTAAGGGG - Intergenic
959012126 3:101089758-101089780 AAGGAATAATAAGGAATAAGTGG + Intergenic
959287963 3:104440531-104440553 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
959485369 3:106923337-106923359 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
961149545 3:124625712-124625734 AATGAACATTTGGGCATATGGGG - Intronic
961293912 3:125868903-125868925 AAGGAATATTTTGTGGTAAGGGG - Intergenic
961711235 3:128829819-128829841 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
961712265 3:128836681-128836703 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
961892016 3:130138209-130138231 AAAGAATATTTTGTGGTAAGGGG + Intergenic
962523484 3:136218070-136218092 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
963129043 3:141841127-141841149 AAGGACTCTTTTATCATAAGTGG - Intergenic
963456291 3:145551806-145551828 AAGGAAGATTTTGTGGTAAGAGG + Intergenic
963522047 3:146367373-146367395 AAGGAAGATTTTGTAGTAAGGGG - Intergenic
964056742 3:152470270-152470292 AAGGAATATTCTGGTATGAGTGG + Intergenic
964068287 3:152602552-152602574 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
964124985 3:153226731-153226753 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
964132506 3:153305798-153305820 AAGGAATATTTGTTCATAAAAGG + Intergenic
964299755 3:155275011-155275033 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
964529038 3:157647192-157647214 AAGGAATATTTAGTGATAACAGG + Intronic
964838537 3:160968153-160968175 AAAGTAGATTTTGGAATAAGAGG + Intronic
964906139 3:161722492-161722514 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
964984044 3:162717670-162717692 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
965104850 3:164342757-164342779 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
965624439 3:170672758-170672780 AAGGAAGATTTTGTGGTAAGTGG + Intronic
965639581 3:170818186-170818208 AAGGAAGATTTTGTGGTAAGAGG + Intronic
965713809 3:171581531-171581553 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
965845476 3:172956073-172956095 AAGCATTATTTTGGTTTAAGAGG - Intronic
965861485 3:173155801-173155823 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
965959200 3:174408479-174408501 ATGGAATGTTTTGGCAACAGAGG + Intergenic
966085879 3:176066739-176066761 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
966232456 3:177666456-177666478 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
966279869 3:178214055-178214077 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
966397174 3:179515863-179515885 AAGGAATATTTTGTGATAAGGGG + Intergenic
966398051 3:179521889-179521911 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
967004844 3:185374406-185374428 AAGGAAGATTTTGTGGTAAGGGG + Intronic
967152522 3:186663100-186663122 AAGGAAGATTTTGTGGTAAGGGG - Intronic
967243788 3:187466881-187466903 AAGGAAGATTTTGTGGTAAGAGG + Intergenic
967496622 3:190149605-190149627 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
967561782 3:190925218-190925240 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
967643425 3:191895947-191895969 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
967657715 3:192071693-192071715 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
967740863 3:193000792-193000814 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
968274790 3:197432325-197432347 AAGGAATATTTTCCAATAGGGGG - Intergenic
1202747365 3_GL000221v1_random:117854-117876 AAGGAATAGATGGTCATAAGAGG - Intergenic
968401189 4:299209-299231 AAAGAATATTTTGACCTAAAAGG + Intronic
968412235 4:400170-400192 AAGAAAGATTTTGGGTTAAGGGG + Intergenic
968993759 4:3932477-3932499 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
969003400 4:4000659-4000681 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
969750622 4:9107868-9107890 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
969810529 4:9644166-9644188 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
970028802 4:11654137-11654159 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
970042456 4:11811388-11811410 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
970087970 4:12369086-12369108 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
970533187 4:17003280-17003302 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
970819783 4:20198591-20198613 AAGTAAGATTTTGGGGTAAGGGG - Intergenic
970853593 4:20630349-20630371 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
971716342 4:30182149-30182171 GAGGAAGATTTTGGCATGAACGG + Intergenic
973181360 4:47272712-47272734 AAGGAATATTTTGGATGTAGTGG - Intronic
973751524 4:54024920-54024942 AAGGAAGATTTTGTGGTAAGGGG - Intronic
974090827 4:57309497-57309519 ACGGCATATATGGGCATAAGTGG - Intergenic
974172955 4:58291301-58291323 AAGGAAGATTTTGTGATAAAGGG + Intergenic
974904341 4:68037011-68037033 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
975286146 4:72622916-72622938 AATGTATTTTTTGGCATAAATGG - Intergenic
976470868 4:85427295-85427317 AAGAGATATTTTGACAAAAGAGG - Intergenic
976559017 4:86479872-86479894 AAGGAAGATTTTGTGGTAAGGGG - Intronic
976719085 4:88152899-88152921 AAGGAAGATTTTGTGGTAAGGGG + Intronic
976781323 4:88761751-88761773 AATAAATATTATGGCATAATAGG + Intronic
977470940 4:97441586-97441608 AAAGAATATTTTGACTTAGGTGG - Intronic
977782029 4:100992261-100992283 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
977824705 4:101517272-101517294 AAGGAAGATGTTGGGAGAAGAGG - Intronic
977965479 4:103142539-103142561 AAGGAAAATGATGGCCTAAGAGG - Intronic
978155316 4:105483307-105483329 TAGGAATACCTTGGCAGAAGTGG - Intergenic
978302843 4:107291188-107291210 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
978439007 4:108714258-108714280 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
978490238 4:109303705-109303727 AAGGAACTCTTTGGAATAAGAGG - Intergenic
978695755 4:111575973-111575995 AAGGAATATTTTGGGAGTAATGG - Intergenic
979147003 4:117257195-117257217 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
979170950 4:117600738-117600760 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
979493057 4:121351638-121351660 AAGGAATATTTTTGTATACCAGG + Intronic
980285363 4:130772678-130772700 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
980349546 4:131668260-131668282 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
980389320 4:132123288-132123310 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
980471999 4:133264130-133264152 AAGGAAGATTTTGTGATAAGGGG + Intergenic
980528315 4:134017782-134017804 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
980575252 4:134678515-134678537 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
981040640 4:140218602-140218624 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
981154497 4:141417744-141417766 AAGGATTCTTTTGGCAGAGGCGG - Intergenic
981482487 4:145253239-145253261 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
983055770 4:163097294-163097316 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
983058627 4:163129111-163129133 AAGGGGTATTGTGGCATAATGGG + Exonic
983081111 4:163386717-163386739 ATGGAATATTAGTGCATAAGTGG + Intergenic
983345992 4:166525839-166525861 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
983359392 4:166709230-166709252 AAGGAAAATTTTGTGGTAAGGGG + Intergenic
983369017 4:166835542-166835564 AAGAAATAGTTTGACAGAAGAGG - Intronic
983414358 4:167436625-167436647 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
983448455 4:167881432-167881454 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
983753083 4:171300530-171300552 AAGGAAGTTTTTTGCATAAATGG - Intergenic
983805397 4:171986635-171986657 AAGGAAGATTTTGTGGTAAGGGG + Intronic
983883263 4:172956233-172956255 AAGGAAGATTTTGTGGTAAGGGG + Intronic
984164858 4:176294810-176294832 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
984230245 4:177088923-177088945 AAGAAATATTTTGGAAAAACTGG - Intergenic
984322653 4:178212740-178212762 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
984412209 4:179408736-179408758 AAGGAAGATTTTGTGGTAAGAGG - Intergenic
984437772 4:179726294-179726316 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
985056959 4:186044593-186044615 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
985078546 4:186242492-186242514 AAGGAATATTTTATGGTAAGGGG + Intronic
985436151 4:189931265-189931287 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1202754418 4_GL000008v2_random:45564-45586 AAGGAATAGATGGTCATAAGAGG + Intergenic
986368180 5:7055611-7055633 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
986368202 5:7055776-7055798 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
987060550 5:14239189-14239211 AAGAAGTATTTTAGCATAACAGG - Intronic
987756224 5:22099948-22099970 AAGGAAGATTTTGTGGTAAGGGG - Intronic
987821804 5:22974719-22974741 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
989687951 5:44111022-44111044 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
990564653 5:57017077-57017099 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
990788426 5:59449465-59449487 AAGGAATACTTTTGCACAATGGG - Intronic
990831767 5:59967118-59967140 AAGGGTTACTTTGGCATAATCGG + Intronic
991437066 5:66607779-66607801 AGGTAATATTTTGTAATAAGAGG - Intronic
992451536 5:76880502-76880524 AAGGAAGATTTTGTGGTAAGGGG + Intronic
994105359 5:95941690-95941712 AAGGATTATCTTGGGAGAAGAGG - Intronic
994325393 5:98440395-98440417 AAGAAAGATTTTGGGGTAAGGGG - Intergenic
994375302 5:99011424-99011446 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
994532172 5:100984894-100984916 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
994778497 5:104064260-104064282 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
995124658 5:108568244-108568266 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
995297049 5:110534929-110534951 AAGGAAGATTTTGTGGTAAGGGG - Intronic
995409220 5:111835693-111835715 TAGGAACATTCTGGGATAAGTGG + Intronic
996164398 5:120207078-120207100 CCAGAATATTTTGGGATAAGAGG + Intergenic
996202869 5:120698210-120698232 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
996357965 5:122617520-122617542 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
996372143 5:122764778-122764800 ATGGAAAATATTTGCATAAGTGG - Intergenic
996510291 5:124308872-124308894 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
996574588 5:124967260-124967282 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
996918167 5:128735376-128735398 AAGAAAGATTTTGGGGTAAGGGG - Intronic
998539000 5:142961540-142961562 AAGGAAAATCATGGCATAATAGG + Intronic
998633349 5:143925541-143925563 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
998693293 5:144611929-144611951 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
999344478 5:150803986-150804008 ATGGAATCTCTGGGCATAAGGGG + Intergenic
999601521 5:153271177-153271199 AAGGAATATTTTAATCTAAGAGG + Intergenic
1000519005 5:162276009-162276031 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1000935172 5:167298206-167298228 AAGGAAGATTTTGTGGTAAGGGG + Intronic
1000976055 5:167765534-167765556 ATGCAATATTTTGGCCTAATGGG + Intronic
1001331065 5:170762655-170762677 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1001353773 5:171001204-171001226 AAGAAAGATTTTGGGGTAAGGGG + Intronic
1001443570 5:171764584-171764606 AAGAAATTTTCTGGCATAAAAGG + Intergenic
1002428605 5:179190319-179190341 AAGGAAGATTTTGGGGTAACAGG + Intronic
1003100535 6:3173263-3173285 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1004106660 6:12672464-12672486 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1004575622 6:16891053-16891075 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1004768178 6:18754704-18754726 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1004837441 6:19544220-19544242 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1006325571 6:33351235-33351257 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1007083037 6:39122355-39122377 AAGCAAGATTTTGGGGTAAGGGG - Intergenic
1007300183 6:40861991-40862013 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1007891671 6:45299995-45300017 ATGGGAAATTCTGGCATAAGTGG + Intronic
1008230046 6:48975227-48975249 AAGGAATATTTTCACAGAAAAGG - Intergenic
1008849729 6:56010763-56010785 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1009270281 6:61605633-61605655 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1009359756 6:62796852-62796874 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1009379594 6:63010849-63010871 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1009460765 6:63910026-63910048 AAGGAATATTGTTGCTTAAGGGG + Intronic
1009464847 6:63955972-63955994 AAGGAAGATTTTGTGGTAAGGGG - Intronic
1009591226 6:65673318-65673340 AAGGAAGATTTTGTGGTAAGAGG + Intronic
1010071284 6:71748975-71748997 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1010358724 6:74966739-74966761 AAGTAATATTTTGGAATAGGTGG + Intergenic
1010829248 6:80510374-80510396 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1010840872 6:80648115-80648137 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1011367477 6:86598815-86598837 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1012293760 6:97494058-97494080 CAGGAATATTTTAACATAATAGG + Intergenic
1012524850 6:100165116-100165138 AGGAAATAATTTGACATAAGAGG - Intergenic
1012666020 6:101970970-101970992 CAGCATTATTTTGGCATAATGGG + Intronic
1012675550 6:102107564-102107586 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1012954712 6:105557050-105557072 AAGGAATAATTTAGGATAAAAGG - Intergenic
1013248069 6:108306807-108306829 AAGGAATATATTGTGATATGGGG - Intronic
1013407493 6:109856355-109856377 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1013807601 6:114012452-114012474 AAGAAATATTTTGGGGTAAGGGG + Intergenic
1014160620 6:118163740-118163762 AAGCACTATTTTGGCAGAAGGGG - Intronic
1014486477 6:122005133-122005155 AAAGAGTATTGTGCCATAAGGGG - Intergenic
1014614275 6:123582903-123582925 AAGGAAGATTTTGTGGTAAGGGG + Intronic
1014891931 6:126853833-126853855 AAGGAAGATTTTGTGATAAGGGG - Intergenic
1015413424 6:132920776-132920798 AGGGAATAGTTGGGCAAAAGTGG + Intergenic
1015800837 6:137060865-137060887 AAGGAAGATTTTGTGGTAAGAGG + Intergenic
1016363067 6:143288462-143288484 AAGGAATATTTATCCATAAGTGG - Intronic
1016535360 6:145103758-145103780 AAGGAAAATTTTGTGGTAAGGGG + Intergenic
1016751047 6:147631129-147631151 AAGGAAGATTTTGTGGTAAGGGG + Intronic
1016853670 6:148644907-148644929 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1017270365 6:152496583-152496605 AAGAAAGATTTTGGGGTAAGGGG - Intronic
1017389899 6:153926584-153926606 AAGGAAGATTTTGCGGTAAGGGG - Intergenic
1017778949 6:157701259-157701281 AAGGAAGATTTTGTGGTAAGGGG + Intronic
1017922010 6:158880976-158880998 AAGAAAGATTTTGGGGTAAGGGG + Intronic
1018521080 6:164652721-164652743 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1020316377 7:6908391-6908413 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1020322358 7:6948769-6948791 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1020794632 7:12664945-12664967 AAGGAACATTTTGTGGTAAGGGG - Intergenic
1021408136 7:20297860-20297882 AAGGCTTATTTGGGCATGAGAGG - Intergenic
1022572364 7:31467431-31467453 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1022709495 7:32837681-32837703 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1023021525 7:36015976-36015998 AGGGAATGTTTTGGTATAATAGG - Intergenic
1023399599 7:39782698-39782720 AAGGCATCTTTTGACATAAAGGG - Intergenic
1026356192 7:69559549-69559571 AAGGGATATTTTGTCATATCAGG - Intergenic
1026398909 7:69989054-69989076 AAGAAATACTTTGGAATAAATGG + Intronic
1027354874 7:77345258-77345280 AAGGAAGATTTTGTGGTAAGGGG - Intronic
1028589386 7:92479756-92479778 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1028670893 7:93399020-93399042 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1028690559 7:93644954-93644976 AAGGAAGATTTTGTGGTAAGGGG - Intronic
1028872971 7:95788813-95788835 AAGGAATGTTCTGGAATATGGGG + Intronic
1028887014 7:95945400-95945422 AAGGAATATTTATGCAAAATTGG - Intronic
1029500655 7:100927414-100927436 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1030062953 7:105637587-105637609 AATAAATATTTTTGAATAAGTGG + Intronic
1030441263 7:109592433-109592455 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1030751222 7:113235073-113235095 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1030887745 7:114959695-114959717 TAGGAAGACTTTGGAATAAGTGG + Intronic
1030978330 7:116154943-116154965 AAGGGATAGTATGGCAGAAGAGG - Intronic
1031005051 7:116460550-116460572 AAGGAAGATTTTGTGGTAAGGGG - Intronic
1031297036 7:120014188-120014210 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1031354732 7:120777194-120777216 AAGGAAGATTTTGTGGTAAGAGG + Intergenic
1031364378 7:120886238-120886260 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1031422017 7:121564217-121564239 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1031686236 7:124734133-124734155 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1031704181 7:124961237-124961259 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
1031777845 7:125923509-125923531 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1032840505 7:135709794-135709816 GAGGAATATTCTGGAATCAGAGG - Intronic
1033212028 7:139467098-139467120 AAGGAAGATTTTGTGGTAAGGGG - Intronic
1033909076 7:146243988-146244010 AAGGAAGATTTTGTGGTAAGGGG + Intronic
1034084328 7:148309996-148310018 AAGGAAGATTTTGTGGTAAGGGG + Intronic
1035880230 8:3238575-3238597 AAGGAAGATTTTGTGGTAAGGGG + Intronic
1036070490 8:5437039-5437061 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1036131549 8:6118922-6118944 AAGGAAAATTATGCCATAAAAGG - Intergenic
1036550166 8:9808747-9808769 AAGGAAGATTTTGTGGTAAGAGG - Intergenic
1036828737 8:12002680-12002702 AAGAGATGTTTTGGCATAATAGG - Intergenic
1039906709 8:41791736-41791758 AAGCAATATTTTGGAAGAAAGGG - Intronic
1040648551 8:49425772-49425794 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1041147038 8:54887820-54887842 AGGGAACTTTTTGGCATAATAGG - Intergenic
1041866250 8:62577273-62577295 AATGCATATTTTCTCATAAGTGG + Intronic
1041891270 8:62871653-62871675 AAGGAAGAATGTGGCAGAAGAGG + Intronic
1041916992 8:63147968-63147990 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
1041917021 8:63148210-63148232 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1041946433 8:63448751-63448773 AAGGTATCTTTTGACAAAAGAGG - Intergenic
1042528597 8:69792309-69792331 AAGTAAAATTTGGGCATAAAGGG + Intronic
1043580316 8:81704663-81704685 AACAAAAATTTTGGCATAACAGG + Intronic
1043599401 8:81919332-81919354 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1043717450 8:83505266-83505288 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1043721431 8:83550038-83550060 AAGAAAGATTTTGGGGTAAGGGG - Intergenic
1043838175 8:85068555-85068577 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1044411625 8:91890375-91890397 AATGAACATTTTGGCAAAAAAGG - Intergenic
1045429896 8:102103814-102103836 GAGAAACATTTTGGCATATGAGG + Intronic
1045533268 8:103004008-103004030 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1046294515 8:112200863-112200885 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1046393027 8:113601914-113601936 AAGGGATGTGTTGGCAGAAGTGG + Intronic
1046559562 8:115818821-115818843 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1047289187 8:123514249-123514271 CATGAATATTTTGGAAAAAGTGG - Exonic
1047850044 8:128847197-128847219 AAGGAATTTTAAGGCAGAAGAGG - Intergenic
1047856811 8:128919716-128919738 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1048135880 8:131746034-131746056 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1048193673 8:132313168-132313190 AAAGAATATTGTGGTATGAGTGG + Intronic
1048585043 8:135767787-135767809 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1048763800 8:137825214-137825236 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1050118054 9:2280828-2280850 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1050257637 9:3811473-3811495 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1050697277 9:8293141-8293163 CAGGCATATCTTGGCATCAGAGG - Intergenic
1050896502 9:10890121-10890143 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1051730084 9:20131920-20131942 TGGGAATAATTTGGCATAAATGG + Intergenic
1051952997 9:22659095-22659117 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1052163568 9:25293552-25293574 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1052192293 9:25674573-25674595 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1052545218 9:29868879-29868901 AAGGATTATTTTTGCATTGGTGG + Intergenic
1052657760 9:31385296-31385318 AAAGAATATTTTGGAAAAATTGG - Intergenic
1052664192 9:31473042-31473064 TAGAAATATTTTGTTATAAGTGG - Intergenic
1052720219 9:32164941-32164963 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1053078059 9:35151766-35151788 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
1053783223 9:41631812-41631834 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1054171176 9:61841954-61841976 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1054666357 9:67738858-67738880 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1054807036 9:69405146-69405168 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1055347233 9:75351725-75351747 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1055882194 9:81014679-81014701 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1055911669 9:81359953-81359975 AAGGGATATTTTGGCTCAAAGGG - Intergenic
1057009923 9:91591645-91591667 AGGGAACACTTTGGCAGAAGAGG + Intronic
1058025734 9:100140760-100140782 AAGGAAGATTTTGTGGTAAGGGG + Intronic
1058612821 9:106793661-106793683 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1059386458 9:113968700-113968722 AAAGAATATTTTAACATAATAGG + Intronic
1059400635 9:114068244-114068266 AATGAATATTTAGTCATGAGAGG - Intronic
1059545780 9:115175232-115175254 AAGGAAGATTTTGTGGTAAGGGG + Intronic
1060318037 9:122531177-122531199 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1060737439 9:126075017-126075039 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1061583364 9:131551336-131551358 AAGGAAGATTTTGTGGTAAGAGG - Intergenic
1061643526 9:131979744-131979766 AAGGAATATTTTGGCATAAGTGG - Intronic
1203756639 Un_GL000218v1:135293-135315 AAGGAATAGATGGTCATAAGAGG - Intergenic
1203716001 Un_KI270742v1:147945-147967 AAGGAATAGATGGTCATAAGAGG - Intergenic
1203535211 Un_KI270743v1:30291-30313 AAGGAATAGATGGTCATAAGAGG + Intergenic
1186112453 X:6272797-6272819 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1187017288 X:15342337-15342359 AAGAAATATTTTTACACAAGCGG + Intergenic
1187086128 X:16045298-16045320 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1187099585 X:16179787-16179809 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1187103360 X:16217424-16217446 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
1187233660 X:17446112-17446134 AAGGAAGATTTTGTGGTAAGGGG - Intronic
1188311996 X:28628528-28628550 AAGGATTATTTAGGCATCATAGG + Intronic
1188332539 X:28892743-28892765 AAGGAAGATTTTGTGGTAAGGGG + Intronic
1188419945 X:29980646-29980668 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1188431465 X:30108652-30108674 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1188462966 X:30449510-30449532 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1188553094 X:31382727-31382749 AAGGAAGATTTTGTGGTAAGGGG - Intronic
1189136039 X:38551476-38551498 AAGGAAGATTTTGTGGTAAGGGG - Intronic
1190334348 X:49253379-49253401 GAGAACTATTTTGGCAGAAGTGG - Intronic
1190481779 X:50884489-50884511 AGGTAATAAGTTGGCATAAGTGG + Intergenic
1190990556 X:55545366-55545388 AAGACATATTTAGGCATAAAAGG - Intergenic
1191013796 X:55788918-55788940 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
1191805334 X:65129859-65129881 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1192455455 X:71272099-71272121 AAGAAAGATTTTGGGGTAAGGGG - Intergenic
1192706632 X:73533357-73533379 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1192730941 X:73801993-73802015 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1192763725 X:74122164-74122186 AAGTAAGATTTTGGGGTAAGGGG + Intergenic
1193537541 X:82732326-82732348 AAGGAATATTTTGGGGTAAGTGG - Intergenic
1193728379 X:85071454-85071476 AAGAAATATGTTGGGATAATTGG + Intronic
1193886316 X:86986894-86986916 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1194367503 X:93028034-93028056 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1194661192 X:96629900-96629922 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1194726164 X:97399841-97399863 GAGGTATATTATAGCATAAGGGG - Intronic
1194873301 X:99159292-99159314 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1194908810 X:99613104-99613126 AAAACATATTTTGGCATAATTGG + Intergenic
1195001105 X:100644324-100644346 AAGGAAACTTTTGGCAGATGTGG + Exonic
1195016536 X:100786955-100786977 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1195290685 X:103429623-103429645 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1195326357 X:103761699-103761721 AAGGAAGATTTTGTGATAAGGGG + Intergenic
1195818025 X:108909809-108909831 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1195841892 X:109183516-109183538 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1196201408 X:112889982-112890004 AAGGAAAATTTTCTGATAAGAGG - Intergenic
1196226728 X:113176768-113176790 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1196300425 X:114045393-114045415 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1196497303 X:116336252-116336274 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1196524982 X:116720894-116720916 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1197471401 X:126868390-126868412 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1197500227 X:127232440-127232462 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1197793690 X:130279636-130279658 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1197933488 X:131717163-131717185 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1198890945 X:141395513-141395535 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
1198966443 X:142232435-142232457 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1198983315 X:142423956-142423978 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1199024873 X:142924579-142924601 AAAAAATATTATGGCATAAAGGG - Intergenic
1199073264 X:143502756-143502778 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1200007224 X:153095164-153095186 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
1200675712 Y:6144293-6144315 AAGGAAGATTTTGTGGTAAGGGG - Intergenic
1201170217 Y:11252906-11252928 AAGGAATAGATGGTCATAAGAGG - Intergenic
1201307027 Y:12559768-12559790 AAGGAAGATTTTGTGGTAAGGGG + Intergenic
1201540357 Y:15099389-15099411 AAGAAAGATTTTGGGGTAAGGGG + Intergenic
1201581755 Y:15517481-15517503 AAGGAAGATTTTGTGGTAAGGGG - Intergenic