ID: 1061643528

View in Genome Browser
Species Human (GRCh38)
Location 9:131979753-131979775
Sequence ATCCAAGGTAAGGAATATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061643528_1061643534 18 Left 1061643528 9:131979753-131979775 CCAAAATATTCCTTACCTTGGAT 0: 1
1: 0
2: 2
3: 8
4: 217
Right 1061643534 9:131979794-131979816 CATGCTAACTCCTTGTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061643528 Original CRISPR ATCCAAGGTAAGGAATATTT TGG (reversed) Intronic
902161994 1:14537975-14537997 ATCCAAGGGCAGGCATCTTTGGG + Intergenic
902318478 1:15642124-15642146 ATCCAAAGTGAGAATTATTTGGG + Intronic
908878259 1:68701924-68701946 AACCAAGGTAAATAAGATTTAGG - Intergenic
909226469 1:73030828-73030850 AACCAAGGGAAGTATTATTTTGG - Intergenic
909929795 1:81483706-81483728 ATCCAATGTAAGGAATAACCTGG - Intronic
910119167 1:83765968-83765990 AAGCAATGTATGGAATATTTTGG - Intergenic
911498259 1:98656730-98656752 ACCCAAGGTAAGTAATAAGTGGG - Intergenic
911644971 1:100328203-100328225 ATCCAAGGCACTGTATATTTGGG + Intergenic
911843609 1:102719018-102719040 AACCTAAATAAGGAATATTTAGG - Intergenic
912620244 1:111148957-111148979 AAACAAGGTAAGGAATGTTGTGG - Intronic
913442682 1:118915470-118915492 TTTAAAGGCAAGGAATATTTAGG - Intronic
915880650 1:159667618-159667640 ATCAATGGAAAGGAATGTTTAGG + Intergenic
916807423 1:168272020-168272042 ATTCCAGGTAATAAATATTTAGG - Intergenic
917708982 1:177665298-177665320 AGTTAAGGTAAGAAATATTTTGG - Intergenic
921564922 1:216705512-216705534 ATTCCAGGTAGGGAATCTTTGGG - Intronic
923023829 1:230188469-230188491 AGACAAGTTAAGGAGTATTTGGG + Intronic
923117218 1:230953209-230953231 ATCCAAGGAGTGGTATATTTGGG - Intronic
924871337 1:248049044-248049066 ATCAAAGGTGAGGAAAATATAGG + Intronic
1063349070 10:5337798-5337820 ATCCAAGGAAAGCAATCTTGAGG + Intergenic
1067723393 10:48747875-48747897 ATCCAAGAAAAGGAAAATCTTGG - Intronic
1068164151 10:53306077-53306099 ATCAATAGAAAGGAATATTTGGG - Intergenic
1069471394 10:68693513-68693535 ATCCAAGTAAAGGAATATGAAGG + Exonic
1070785543 10:79160248-79160270 TTCCAAGGTAAGCAGAATTTGGG + Intronic
1072075685 10:91970692-91970714 TTCCAAGGTAAGAAACATGTAGG - Intronic
1073630881 10:105147805-105147827 ACCCAAGGGAAGGAGAATTTTGG - Intronic
1073885160 10:108030315-108030337 ATCTAATGTAATGAAGATTTTGG - Intergenic
1074102177 10:110362443-110362465 ATCCAAGGGTAAGAATATTTTGG - Intergenic
1074275952 10:112002245-112002267 ATTCAAGGAAAGGACTATTATGG - Intergenic
1078599227 11:12715767-12715789 ATTTCAGGTAAGCAATATTTGGG + Intronic
1079926312 11:26496049-26496071 GACCAAGGTAATGAATATTCTGG + Intronic
1080602571 11:33834153-33834175 ATCAATGGAAAGGAATTTTTAGG - Intergenic
1080729946 11:34939641-34939663 ATCTAAGGTACGGAATATCCTGG + Intronic
1080927592 11:36774158-36774180 ATTCTAGCTAAGGACTATTTTGG + Intergenic
1081562726 11:44233088-44233110 ATCAAAGGGCATGAATATTTTGG + Intronic
1085625893 11:78072623-78072645 TTCAAAGTTAAGAAATATTTAGG + Intronic
1086240297 11:84682410-84682432 TGCAAAGGCAAGGAATATTTTGG + Intronic
1087002817 11:93437975-93437997 TTCCAGTCTAAGGAATATTTTGG + Exonic
1087899338 11:103623055-103623077 ATCCCAGGTAAAGGTTATTTAGG - Intergenic
1090164058 11:124528195-124528217 ATCCAAAATAAGGAACATTTTGG - Intergenic
1092878415 12:12868297-12868319 ATCCAAGGAAAGACATACTTAGG - Intergenic
1093276150 12:17130382-17130404 ATCCAAGTGAGGGAATAGTTGGG + Intergenic
1094039226 12:26105405-26105427 ATCTAAGGAAAGGTATATTAAGG + Intergenic
1095214547 12:39532393-39532415 ATACAAAGTAAAGAATAATTGGG + Intergenic
1095278558 12:40321639-40321661 AATCAAGGTAAGGTTTATTTTGG - Intronic
1095283602 12:40384845-40384867 ATCAGAGGTAAGGAGAATTTTGG - Intergenic
1095366256 12:41409847-41409869 CTCCAAGCTAAGGAATACCTGGG - Intronic
1097382865 12:58916502-58916524 AAACAATGTAAGGAAGATTTAGG - Intronic
1097455568 12:59795473-59795495 ATACAAGGGATGGAATAATTAGG - Intergenic
1097585362 12:61509029-61509051 ATCCTAGGTTATAAATATTTGGG - Intergenic
1098409746 12:70168700-70168722 ATGCAATGGAAGTAATATTTTGG - Intergenic
1099666584 12:85638216-85638238 AGCCATGATAAGTAATATTTGGG + Intergenic
1100068687 12:90683175-90683197 TACCAAGCTAAGGAAGATTTAGG - Intergenic
1100522390 12:95387782-95387804 ATCCATGGCAAAGAGTATTTTGG - Intergenic
1102868710 12:116395097-116395119 ACCTAAGCTAAGGAATATTCAGG + Intergenic
1103426484 12:120839954-120839976 ATCCATGCAATGGAATATTTTGG + Intronic
1103474087 12:121205558-121205580 ATCCTAGAAAAGGAATATCTTGG + Intergenic
1103865322 12:124047116-124047138 AGAAAAGGTAAGTAATATTTAGG + Intronic
1104482966 12:129124487-129124509 ATCCAAGTTAACCATTATTTTGG + Intronic
1105748359 13:23398691-23398713 ATCAACGGAAAGGAATGTTTAGG + Intronic
1105890342 13:24678073-24678095 ATCCAAGCTAAGGGTTTTTTGGG - Intergenic
1106538295 13:30667030-30667052 AGACAAGGCAAGGAATCTTTTGG + Intergenic
1108550273 13:51536850-51536872 ATCCAAGTTACTGAATTTTTTGG - Intergenic
1109168005 13:59059796-59059818 ATCATAGGTAAGGGATATTAAGG - Intergenic
1110045660 13:70827030-70827052 CACCAAGGTAAGGAAGAATTTGG - Intergenic
1110649855 13:77931268-77931290 ATGCAAGGAAAGGCAGATTTGGG - Intergenic
1114511490 14:23265371-23265393 ATTCCAGTGAAGGAATATTTTGG + Intronic
1115803167 14:37019249-37019271 TTCCAAGATAAGGAAGAGTTTGG - Intronic
1121876206 14:97455882-97455904 TTCATAGGTCAGGAATATTTGGG - Intergenic
1126238402 15:46412575-46412597 ATTAAAGGTAAGGAATAAGTTGG + Intergenic
1127700314 15:61493168-61493190 ATGAAAGATAAGGAATATCTTGG - Intergenic
1133379365 16:5316983-5317005 ATCCAAGGGCAGGAAAATATGGG - Intergenic
1134375477 16:13668609-13668631 ATCCAGAGTAAGATATATTTGGG + Intergenic
1135384270 16:22022455-22022477 ATCAAAGGTAATGTGTATTTGGG + Intronic
1135951670 16:26920051-26920073 ATCCAAGAAGACGAATATTTAGG + Intergenic
1137301466 16:47152371-47152393 ATCCACTAGAAGGAATATTTAGG + Intergenic
1140100482 16:71912138-71912160 TTAAAAGGTAAGCAATATTTGGG - Intronic
1141934209 16:87226495-87226517 ACCAAAGGTAAGGATTTTTTTGG - Intronic
1143454173 17:7055165-7055187 TTCCAATGTAATGAAAATTTAGG - Intergenic
1143935058 17:10475306-10475328 ATTCCAGGTAGGGAAAATTTGGG + Intergenic
1144146227 17:12401052-12401074 ATTCAAGGCAAGAAATATATGGG + Intergenic
1146397411 17:32479880-32479902 CTCCAAGGTAAGGAGTCTTAAGG + Exonic
1151147225 17:72052657-72052679 ATCCAAGTTAATGAATTCTTTGG - Intergenic
1153314665 18:3710236-3710258 ACCAAAAGGAAGGAATATTTAGG + Intronic
1153469130 18:5423508-5423530 ACCCAAGGTTAGGAATTTCTTGG + Exonic
1154151084 18:11907215-11907237 ATCAATGGAAAGGAATGTTTGGG - Intronic
1155580400 18:27298914-27298936 ATGGAAGATAAAGAATATTTTGG - Intergenic
1155726654 18:29094081-29094103 ATCCAAGGAAAGGAAGATAAAGG + Intergenic
1156336519 18:36177727-36177749 CTCCAAAGTAAGATATATTTGGG + Intronic
1158170954 18:54598937-54598959 ATCCATGGAAAGGAATGTTCAGG - Exonic
1161215121 19:3090938-3090960 ATCAAAAGAAAGTAATATTTAGG - Intergenic
1166012335 19:39951730-39951752 ATCCAAGGGGGGGAATCTTTTGG + Intergenic
1168363337 19:55762080-55762102 TTTCAAGGTAAGGAATCTATAGG + Exonic
1168364292 19:55772084-55772106 TTTCAAGGTAAGGAATCTATAGG + Exonic
927759507 2:25739974-25739996 GCCCAAGGTACTGAATATTTGGG + Intronic
927999752 2:27512885-27512907 ATCCAAAGTGAGGCATATTCTGG - Intronic
928027332 2:27751146-27751168 AACCAAGGGAAGGAATAAATGGG - Intergenic
930342404 2:50133473-50133495 ATCCAAGCTGATGAAGATTTGGG - Intronic
930356878 2:50332141-50332163 AGGCAATGGAAGGAATATTTAGG + Intronic
931967444 2:67549260-67549282 ATCCCAGGTATGGAAAATGTAGG + Intergenic
932104987 2:68933990-68934012 ATCCTAGATAAGGAAGATTCGGG - Intergenic
932989804 2:76772860-76772882 ATCATAGGTATGGAATATATAGG + Intronic
933670453 2:85002481-85002503 AAACCAGGTAAGGAATATATGGG - Intronic
934093040 2:88571015-88571037 ATCCATTGTAAAGAATATGTTGG + Exonic
935518458 2:104074919-104074941 ATCCAATGTGAATAATATTTAGG - Intergenic
938095952 2:128464034-128464056 ATCCCAGGTATTGTATATTTTGG - Intergenic
940976821 2:159955183-159955205 ATGCAAGGTAAGAAATATTTGGG - Exonic
941584404 2:167339472-167339494 ATCCAACATAATGAATAATTTGG + Intergenic
942306424 2:174611635-174611657 ATTTAGGGTAAGAAATATTTGGG - Intronic
944011108 2:194976553-194976575 ATCCAAGGGTAGGAATAATATGG + Intergenic
944407666 2:199403469-199403491 TTTCAAGGTAAGAAATATCTTGG + Intronic
945742543 2:213680954-213680976 ATCAATGGAAAGGAATGTTTAGG + Intronic
945893601 2:215457440-215457462 ATCCAAGGAAAAGCATATTTAGG - Intergenic
947046691 2:225995129-225995151 ATCCAAGGAAAGGAACATGGAGG + Intergenic
947286890 2:228527089-228527111 ATCCAATGTAACAAATATTGTGG + Intergenic
948080801 2:235203672-235203694 ATCTCAGGTAAGGATAATTTTGG - Intergenic
1172472116 20:35206934-35206956 TTCCCAGTTGAGGAATATTTAGG - Intergenic
1172961506 20:38803740-38803762 ATCCAAAGTCATGAAGATTTAGG + Intergenic
1173084471 20:39902578-39902600 CTAGAAGGAAAGGAATATTTAGG + Intergenic
1173796981 20:45868338-45868360 AGTAAAGCTAAGGAATATTTTGG + Intronic
1174839293 20:53886523-53886545 ATCCATAGAAAGGAATATCTGGG - Intergenic
1175455620 20:59110896-59110918 ATCCATGTTAAGTAATTTTTTGG - Intergenic
1175639417 20:60615201-60615223 ATCCAAGGTAAAGGCTGTTTTGG + Intergenic
1176095374 20:63341229-63341251 ATCCATGGAAAGGAATGTTCAGG - Intergenic
1177032124 21:15993577-15993599 TTACAAGGTAAGGAAGATTGTGG - Intergenic
1178670006 21:34582006-34582028 ATCCAAGGCAAGGTGTATTCTGG + Intronic
1179619408 21:42602956-42602978 ATCAATGGAAAGGAATGTTTAGG + Intergenic
952002678 3:28804694-28804716 ATCAAATGTGAGGAATGTTTAGG - Intergenic
952310816 3:32187886-32187908 ATCCAAGATCATGAAGATTTAGG + Intergenic
953477349 3:43216870-43216892 AAACTAGGTAAGGAATATATTGG + Intergenic
953485962 3:43296036-43296058 ATTCAAAGTAAATAATATTTTGG - Intronic
956307777 3:67845310-67845332 ATCCAAAGAAAGGAATGTCTGGG + Intergenic
957254027 3:77813588-77813610 TTCCAATGTAATAAATATTTTGG + Intergenic
957576848 3:82018666-82018688 ATCAATAGAAAGGAATATTTGGG - Intergenic
960211510 3:114972933-114972955 AATCAAGGTAAAGTATATTTTGG - Intronic
960215925 3:115037259-115037281 ATCCAAAGTAAAGAAATTTTTGG + Intronic
962631535 3:137281073-137281095 ATCACAGCTAAGGAACATTTTGG - Intergenic
963385833 3:144592899-144592921 ATTCATAGTAACGAATATTTGGG - Intergenic
963679739 3:148359261-148359283 CTCCAAGGATAGGAAGATTTGGG - Intergenic
964163548 3:153673989-153674011 ACCAAAGGTAAGGGATTTTTAGG + Intergenic
964334567 3:155641383-155641405 AACACAGTTAAGGAATATTTGGG - Intronic
964851836 3:161104303-161104325 TTCAGAGGTAAGGAAAATTTGGG - Exonic
965463140 3:168993659-168993681 ATCAACAGTAAGGAATATTAAGG - Intergenic
965766258 3:172133540-172133562 ATTCAAGGTAAGGACATTTTTGG + Exonic
971565927 4:28141547-28141569 ATTCAAGGGAAGGAATAATGTGG + Intergenic
971774098 4:30938393-30938415 TTCCAAGTTAATGTATATTTGGG + Intronic
971851699 4:31993065-31993087 ATCAACAGAAAGGAATATTTGGG + Intergenic
971975240 4:33676560-33676582 TGCCAAGGTAAGCCATATTTTGG - Intergenic
972041702 4:34609010-34609032 TTCCAAGGTAAGGAATCCTTGGG - Intergenic
972448613 4:39172702-39172724 AACCAAGGTCAGGAATTCTTAGG + Intergenic
973084619 4:46041513-46041535 ATCCATGGTAAATGATATTTTGG - Intronic
974594954 4:64002360-64002382 ATCAAAGGAAAGGAATGTTCAGG + Intergenic
974948910 4:68564119-68564141 GTACAATGTAAAGAATATTTAGG - Intronic
975112329 4:70642008-70642030 ATCCAAAGTAAGGATTCTGTAGG - Exonic
977529757 4:98186176-98186198 TTTTAAGGTCAGGAATATTTTGG - Intergenic
978426808 4:108592022-108592044 ATACAAGGGCAGGAAAATTTTGG + Intergenic
981946495 4:150350806-150350828 ATACAAGGCAAAGACTATTTTGG + Intronic
983361998 4:166738296-166738318 ATCTATGGTTAGAAATATTTAGG + Intronic
986358483 5:6952071-6952093 ACCATAGGTAAGGAATATCTGGG - Intergenic
986585493 5:9312794-9312816 ATCTGGTGTAAGGAATATTTTGG - Intronic
986658110 5:10035082-10035104 ATCAAGGATGAGGAATATTTTGG + Intergenic
987271764 5:16316599-16316621 ATCCAAGGTTAGGGAATTTTTGG + Intergenic
987720737 5:21628924-21628946 ATCAACAGAAAGGAATATTTGGG - Intergenic
987771941 5:22316474-22316496 ATGCAAGGTAAGCATTATTTGGG - Intronic
987960650 5:24804102-24804124 ATCCACAGTAAGTATTATTTCGG - Intergenic
988016574 5:25567376-25567398 ATCAATGGAAAGGAATGTTTAGG - Intergenic
988229227 5:28452420-28452442 ATGCAAGTTATGGCATATTTTGG - Intergenic
989430592 5:41350536-41350558 CTTCAAGGTATGGAATAATTGGG + Intronic
992282675 5:75198109-75198131 ATTTACGGTAAGGTATATTTAGG - Intronic
992897570 5:81258813-81258835 ATCGTAGGGAGGGAATATTTTGG - Intronic
994839644 5:104906599-104906621 ATTCTGGGTAAGCAATATTTAGG + Intergenic
996927122 5:128841003-128841025 ACCCAAGCTGAGGAATATATTGG + Intronic
1000212205 5:159118087-159118109 ATCCAAGGTGGGAAATTTTTAGG + Intergenic
1000997918 5:167977572-167977594 TTCTAAGGTATGAAATATTTTGG + Intronic
1003013178 6:2445627-2445649 TTCCAAGGTAAGGAATGATAGGG - Intergenic
1003393123 6:5730340-5730362 ATCCAAGGTACTAAATAGTTGGG + Intronic
1004216324 6:13707349-13707371 ATCCAAGGTAAGTCAAAGTTGGG - Intronic
1004812934 6:19279283-19279305 ATCTAAGGTCATGAAGATTTTGG + Intergenic
1004961107 6:20790274-20790296 TTCCATGGAAAGTAATATTTAGG + Intronic
1005323994 6:24681835-24681857 TTCAAAGGTAAGGAGAATTTTGG + Intronic
1007007197 6:38376170-38376192 ATACAAAGTAAAGAAAATTTAGG + Intronic
1008708606 6:54195730-54195752 ATCCAAGGGAGTGAATATATGGG - Intronic
1009376228 6:62973406-62973428 AGCCAAGGTGAAGAATTTTTTGG - Intergenic
1009514641 6:64599255-64599277 ATGGAAGCTAAGGTATATTTGGG + Intronic
1009681821 6:66903951-66903973 GTCCAAGGTAGGGATGATTTAGG - Intergenic
1010046266 6:71447533-71447555 ATCCAAGGAAAGAAAAATATGGG + Intergenic
1011190188 6:84719959-84719981 TTCAAAGGTAAGGAGAATTTTGG + Intronic
1013569146 6:111402990-111403012 ATCCCAGTTAATGGATATTTTGG - Intronic
1014458923 6:121671695-121671717 CTCCAAGGAAAGGAATACTCTGG - Intergenic
1014813708 6:125912276-125912298 TTCAGAGGTAAGGAAAATTTTGG + Intronic
1016343523 6:143086746-143086768 TTCAAAGGTAAGGAGAATTTTGG + Intronic
1017361492 6:153577751-153577773 ATCCAAGGAAGGTAATATTTAGG - Intergenic
1021772219 7:24016240-24016262 ATCCAAGATATGGAATTTTTTGG - Intergenic
1022196672 7:28074414-28074436 ATCCAAGCTAAAGAAGATATGGG + Intronic
1022657365 7:32331674-32331696 ATCCAATGGGAGGCATATTTTGG + Intergenic
1023443652 7:40209852-40209874 ATCCAAGAAATGAAATATTTTGG + Intronic
1026387587 7:69865898-69865920 ATAAAAGGTAAGGAAGAGTTAGG - Intronic
1026413709 7:70155706-70155728 GCCCAAGGGAAGGGATATTTGGG - Intronic
1027425930 7:78061527-78061549 ATTCAAGAGGAGGAATATTTTGG + Intronic
1027565766 7:79791313-79791335 ATTCCAGGTAAAGGATATTTGGG - Intergenic
1027974215 7:85128545-85128567 ATCAAAACTAAGCAATATTTTGG + Intronic
1028463403 7:91121494-91121516 ATGCAAGGAAAGAAATAATTTGG - Intronic
1030356228 7:108545658-108545680 TTCCAACATAAGGAAGATTTAGG + Intronic
1031537112 7:122948113-122948135 ACCACAGGTAATGAATATTTGGG - Intergenic
1033146780 7:138878000-138878022 ATCCTTGGAAAGAAATATTTGGG - Intronic
1034980198 7:155470975-155470997 ATCCAAGGGCACTAATATTTGGG - Intergenic
1035516520 8:238189-238211 AGCCAAGGTAGAGAATTTTTAGG + Intronic
1035747358 8:1972031-1972053 ATCTAAGGTAAGAAAAATATGGG + Intergenic
1037706898 8:21322948-21322970 AACCAAGGCAGGGAACATTTTGG + Intergenic
1041516229 8:58701576-58701598 CTCCACTGAAAGGAATATTTTGG + Intergenic
1043964276 8:86454610-86454632 ATTGGAGGTATGGAATATTTAGG - Intronic
1044275217 8:90291362-90291384 ATCCAAGATGAGGAAGATTATGG - Intergenic
1044510347 8:93070143-93070165 ATCAGAGGTAAGGAGAATTTTGG - Intergenic
1045846849 8:106646972-106646994 ATTCCAGGTATGGAGTATTTGGG + Intronic
1048206590 8:132420322-132420344 ACCCAAGGGAAGGAATATTTGGG + Intronic
1051901751 9:22050444-22050466 ACCAAAGGAAAGGAGTATTTGGG + Intergenic
1055449513 9:76418216-76418238 ATCAATAGAAAGGAATATTTGGG + Intergenic
1059809295 9:117838057-117838079 ATTCAAGGAAAGGAATATGGTGG - Intergenic
1061643528 9:131979753-131979775 ATCCAAGGTAAGGAATATTTTGG - Intronic
1186025567 X:5306946-5306968 ACCCAATATAAGGAATATTGTGG - Intergenic
1186300333 X:8193869-8193891 ATCCAAAATAAGGAAAATCTCGG - Intergenic
1186782743 X:12929739-12929761 CTTCAAGGTAAGGAATACTGTGG - Intergenic
1187708745 X:22032792-22032814 AGCCAAGGCAACCAATATTTTGG + Exonic
1188080964 X:25840040-25840062 ATCCAATGTAAAAAATAATTGGG + Intergenic
1188849927 X:35119502-35119524 ATCAGAGGTAAGAAATACTTGGG + Intergenic
1189219474 X:39358859-39358881 ATTCAAGGTAAGGAATATGCAGG + Intergenic
1195047763 X:101069297-101069319 ATCCCAGCTCAGGAATATATAGG + Intergenic
1199840912 X:151647655-151647677 ATCCAAAATACGTAATATTTAGG - Intronic
1200424608 Y:3007434-3007456 ATCCAATGTTAGGAACATTGGGG + Intergenic