ID: 1061643531

View in Genome Browser
Species Human (GRCh38)
Location 9:131979763-131979785
Sequence GACAGAACCCATCCAAGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061643531_1061643537 30 Left 1061643531 9:131979763-131979785 CCTTACCTTGGATGGGTTCTGTC 0: 1
1: 0
2: 1
3: 7
4: 114
Right 1061643537 9:131979816-131979838 GCACCTGAAAACAAGATGGCTGG No data
1061643531_1061643534 8 Left 1061643531 9:131979763-131979785 CCTTACCTTGGATGGGTTCTGTC 0: 1
1: 0
2: 1
3: 7
4: 114
Right 1061643534 9:131979794-131979816 CATGCTAACTCCTTGTAGAGTGG No data
1061643531_1061643536 26 Left 1061643531 9:131979763-131979785 CCTTACCTTGGATGGGTTCTGTC 0: 1
1: 0
2: 1
3: 7
4: 114
Right 1061643536 9:131979812-131979834 AGTGGCACCTGAAAACAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061643531 Original CRISPR GACAGAACCCATCCAAGGTA AGG (reversed) Intronic
900923057 1:5685836-5685858 CACAGAACCCTTCCTAGGTGGGG + Intergenic
903223341 1:21881085-21881107 CACAGAACCCAGCCCAGGCATGG + Intronic
905727330 1:40264376-40264398 GCCACAAACCATACAAGGTATGG - Intronic
906049521 1:42858761-42858783 TAAAGAAGCCACCCAAGGTAAGG + Intergenic
913460045 1:119075617-119075639 GACAAAGCCCAGCCAAGGAATGG - Intronic
919324728 1:196092340-196092362 GAAAGAACCCAGAGAAGGTAGGG + Intergenic
919942510 1:202297882-202297904 GACACATCCCAACCAAGGCAAGG - Intronic
920336754 1:205250045-205250067 GACAGGACCCCTACAAGGCAAGG - Intronic
922046378 1:221949809-221949831 TAAAGAAGCCACCCAAGGTAAGG + Intergenic
1063182280 10:3614982-3615004 GACAGAACCCACACATGGTAGGG - Intergenic
1063804911 10:9627812-9627834 AACAGAACCCACCCATTGTATGG - Intergenic
1066230590 10:33428993-33429015 GACACAACCCACCCAAGGATGGG - Intergenic
1067850880 10:49752784-49752806 GACAGACCTCCTCCAGGGTAAGG + Intronic
1070990573 10:80728637-80728659 GACAGAACTAATCCAATGCAGGG + Intergenic
1074788611 10:116864098-116864120 GACAGAACCAACACCAGGTATGG - Intronic
1075447877 10:122526430-122526452 GACAGAAGCCACCCAAATTAGGG - Intergenic
1075928971 10:126278017-126278039 GACAGAACTCATCCCAGTGAGGG + Intronic
1079047773 11:17123068-17123090 GACAGAACACAAAAAAGGTAAGG + Intronic
1079099764 11:17533862-17533884 GACAGAACCCAGCTAAGGTCAGG - Intronic
1080250311 11:30226429-30226451 GACAGAAATCATCCAAAGTTTGG - Intergenic
1094285199 12:28784635-28784657 GCCAGAACCCATCTAAGGTTAGG - Intergenic
1098720532 12:73892041-73892063 TACAGAAGCCATCCAAGGCAAGG + Intergenic
1099537208 12:83858689-83858711 GACAGGAAACATCCAAGGCAAGG - Intergenic
1103609905 12:122116939-122116961 GACACAGCCCATCCCAGGCAGGG + Intronic
1104848890 12:131861727-131861749 CACAGAACCCATCCAGGCTGGGG + Intergenic
1104873431 12:132016665-132016687 CACAGAACCCAACCAAGGCCGGG - Intronic
1106343356 13:28852353-28852375 ACCAGACCCCATCCAAGGTGTGG - Intronic
1107462796 13:40620281-40620303 AACAGAACTCATCCAGAGTAGGG + Intronic
1110351051 13:74507914-74507936 GAAAGAAGCCATCCAAGTTGAGG + Intergenic
1111662330 13:91226667-91226689 CTCTGAACCCATCCAAGGAATGG + Intergenic
1113973687 13:114210759-114210781 GGCTGAAGCCATCCAAGGTGGGG - Intergenic
1115783835 14:36801862-36801884 GACAGAACACATTCAAAGCATGG + Intronic
1123203447 14:106690786-106690808 ACCAGAACCCAACCAAGGTGGGG + Intergenic
1126458949 15:48895181-48895203 AACAGTACCATTCCAAGGTATGG + Intronic
1129928834 15:79391248-79391270 GACAAAACCTATCAAAGGTGTGG - Intronic
1133452225 16:5913263-5913285 GAAACAACCCATACATGGTAGGG - Intergenic
1134870858 16:17651242-17651264 GGAAGAACCCATCCAAGGAGAGG - Intergenic
1136453659 16:30368982-30369004 CACACAACCCATCAAAGGCAAGG + Intronic
1138087579 16:54147250-54147272 GAAAGAAACCATCCGAGATAAGG - Intergenic
1138985902 16:62328216-62328238 GACAAAACCCATGCAGAGTAGGG + Intergenic
1139922592 16:70469313-70469335 GGCAGTACCCACCCATGGTAAGG - Exonic
1141409133 16:83820669-83820691 CACAGGCCCCATCCAAGGCAGGG + Intergenic
1143040853 17:4035463-4035485 GTCAGAACCCAAGCAGGGTATGG + Intronic
1148768353 17:50052601-50052623 GATGGATCCCATCCAAGGTTTGG + Intergenic
1149586095 17:57788036-57788058 GGCAGCACCCACCCAAGGAATGG - Intergenic
1152839560 17:82558351-82558373 AACAGAACCGATGCAAGGGAAGG + Intronic
1156466256 18:37349398-37349420 GAAAGAATCCAGCCACGGTAGGG - Intronic
1160007064 18:75075481-75075503 GAGGGAACCCCTCCAAGGAAGGG - Intergenic
1164207499 19:23070798-23070820 GGCAGGCCCCATCCCAGGTATGG - Intergenic
1166149208 19:40859183-40859205 GACAGTACCCATGCATGGTTAGG + Intronic
1166891957 19:45999448-45999470 GAGAGAGCCCATCTAGGGTATGG + Intronic
1168623517 19:57898027-57898049 TACAGTAACCATCCAAGGAAAGG + Intronic
926764226 2:16308980-16309002 GACAGAGTCCATCCCAGGTCTGG + Intergenic
929057625 2:37891914-37891936 GTCATAACCCACCCAAGGGAAGG + Intergenic
929204208 2:39272277-39272299 GACAGAATACTGCCAAGGTAAGG - Exonic
929889965 2:45910769-45910791 GAGAGAACCTAGCCAAGGTTAGG + Intronic
930243779 2:48962812-48962834 CACAACACCCATCCAAGGAATGG - Exonic
930368117 2:50469059-50469081 GAAAAAAGCCATCCAAAGTATGG + Intronic
932485090 2:72079895-72079917 CACACAACCCATCCAAGGGTGGG + Intergenic
932737469 2:74264334-74264356 GACAGAACAGCTCCAGGGTATGG + Intronic
936926081 2:117738049-117738071 GACAGCAACCATCCAAGAGAAGG - Intergenic
937520330 2:122706096-122706118 GACAGAACCCACTCATGGCAGGG + Intergenic
938114101 2:128591663-128591685 GACAGAAGCCATTCTAGGCAGGG + Intergenic
940449147 2:153816582-153816604 GACAGAACCAATACAATGGATGG + Intergenic
944694709 2:202190477-202190499 GTGAGGACCCTTCCAAGGTAGGG + Exonic
945919252 2:215738603-215738625 GACAGAACTCATCCATTGTTTGG - Intergenic
945964833 2:216175562-216175584 GACTGAAACCATACAAGTTATGG - Intronic
947644907 2:231731464-231731486 GACAGAACACATCAAAGGTATGG - Intergenic
948574555 2:238941323-238941345 GACTGAAGCCCTCCCAGGTACGG + Intergenic
1169366251 20:4995227-4995249 GACAGAAAGAATCCAAGCTAGGG + Intronic
1170625003 20:18023592-18023614 CACAGAGCCCATTCAAGGGAGGG + Intronic
1174057987 20:47811846-47811868 GCCAGACCCCATCCTAGGCATGG + Intergenic
1181678264 22:24472115-24472137 GATAGAACCCACACAAGGAAAGG - Intergenic
1184279097 22:43426971-43426993 GACAAAACCCAGCCCAGGGAAGG - Intronic
949958411 3:9289737-9289759 CCCAGAACCTGTCCAAGGTAAGG - Intronic
960264066 3:115599913-115599935 GACAGAATCTATCCATGGTCTGG - Intergenic
962750563 3:138432147-138432169 CACAGATTCCATCCCAGGTAGGG + Intergenic
972225146 4:37003858-37003880 GTCAGGTCCCATCCATGGTAGGG - Intergenic
972296223 4:37741696-37741718 GACAGGACCTATCCTAGGTATGG - Intergenic
974821869 4:67077224-67077246 GACAGTATCCATCCTAGGCATGG - Intergenic
977344330 4:95798614-95798636 GACATAACCTAGCCATGGTATGG + Intergenic
977926356 4:102705076-102705098 GACAGAAAACACCTAAGGTAAGG + Intronic
980223441 4:129949121-129949143 GGCAGAATCCTTCAAAGGTAAGG + Intergenic
981761277 4:148198008-148198030 GACAGAAAGCTTCCAAGGTTAGG + Intronic
983079866 4:163371974-163371996 GCCAGAACCAATCCATGGTCAGG - Intergenic
983673054 4:170260196-170260218 CACACAAGCCATCCAAGGAAAGG + Intergenic
984594956 4:181656279-181656301 GACAGAAGCCAGCCAAAGAAAGG + Intergenic
987069326 5:14321254-14321276 GGCAGGACCCATCCAAGGAGCGG + Intronic
995601178 5:113798470-113798492 GAGAGAACTCATCTAAGGGAAGG + Intergenic
999907813 5:156162855-156162877 TATAGAACCCATTCAAGTTAAGG - Intronic
1001562532 5:172678715-172678737 GACAGAATGGATCCAAGGCAAGG - Intronic
1003923952 6:10859480-10859502 GACAAGCCCCATCCAAGTTATGG - Intronic
1007282593 6:40723416-40723438 GGCAGAACAGATCCAAGGAAGGG + Intergenic
1007287963 6:40761815-40761837 GGCAGGACCCATCCAGGGTTGGG + Intergenic
1010003602 6:70972225-70972247 GACAGAACCCATGATAGGGAGGG - Intergenic
1010261331 6:73820633-73820655 CACAGAACCAATCCAATGTGTGG - Intronic
1012015540 6:93845054-93845076 GGCAGAAACCATCAAAGGCATGG + Intergenic
1014255512 6:119157111-119157133 GCCACAAGCCATCAAAGGTAAGG - Intergenic
1016416660 6:143841148-143841170 GACACAACCAAACCAAGGTGGGG + Intronic
1017249936 6:152269436-152269458 CACAAAACCCATCTAAGTTATGG + Intronic
1020467997 7:8502944-8502966 TAGAGAACCCATCCATGGTAAGG + Intronic
1024392088 7:48827020-48827042 GACTTAACTCATCCAAGGTAAGG + Intergenic
1029020851 7:97363740-97363762 GACAGGAAACATCCAAGGCAAGG + Intergenic
1030085151 7:105809652-105809674 CACAGAAACCCTTCAAGGTAAGG + Intronic
1030193429 7:106831574-106831596 TAAAGAAACCACCCAAGGTAAGG + Intergenic
1034348973 7:150404493-150404515 GATAAAACCCACACAAGGTAGGG + Intronic
1034461145 7:151198701-151198723 GGCAGAACCCATGCAGGGGATGG + Intronic
1034843006 7:154417228-154417250 GACAGAAACCATTCCAGATAAGG - Intronic
1036733927 8:11290690-11290712 GACATAAACCAGCCAAGGTTGGG - Intronic
1038219143 8:25591197-25591219 CACAGAAACCATCCTAGGGAGGG - Intergenic
1041088286 8:54278171-54278193 GACAGAAACCAGCCCAGGTCAGG + Intergenic
1045510345 8:102808082-102808104 GACAGCAGCCATCCAAGGCCAGG - Intergenic
1046090932 8:109501965-109501987 GAGAGAACTGATCTAAGGTAAGG - Intronic
1048196437 8:132335568-132335590 GACAGAGCCCAGCAAAGGTTGGG + Intronic
1056006377 9:82275901-82275923 GACAGATGCAATCAAAGGTATGG - Intergenic
1059146678 9:111905843-111905865 TACAGAAGCCATCCACCGTAAGG - Intronic
1061447775 9:130651006-130651028 GCCAGAGCCTATCCCAGGTAGGG + Intergenic
1061643531 9:131979763-131979785 GACAGAACCCATCCAAGGTAAGG - Intronic
1186441933 X:9593939-9593961 CCCAGAACACAGCCAAGGTAGGG - Intronic
1189921125 X:45904113-45904135 GGGAGAAGCCATCCAAGGCAGGG + Intergenic
1192350572 X:70352815-70352837 GGTAGAGCCTATCCAAGGTAGGG - Intronic
1198571924 X:137966448-137966470 AACAGTACTCATTCAAGGTAAGG + Intergenic
1200097250 X:153670071-153670093 GACCGAAAGCATCCAAGGGAAGG + Exonic