ID: 1061643532

View in Genome Browser
Species Human (GRCh38)
Location 9:131979768-131979790
Sequence TAGTAGACAGAACCCATCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061643532_1061643534 3 Left 1061643532 9:131979768-131979790 CCTTGGATGGGTTCTGTCTACTA 0: 1
1: 0
2: 0
3: 14
4: 94
Right 1061643534 9:131979794-131979816 CATGCTAACTCCTTGTAGAGTGG No data
1061643532_1061643539 29 Left 1061643532 9:131979768-131979790 CCTTGGATGGGTTCTGTCTACTA 0: 1
1: 0
2: 0
3: 14
4: 94
Right 1061643539 9:131979820-131979842 CTGAAAACAAGATGGCTGGCTGG No data
1061643532_1061643536 21 Left 1061643532 9:131979768-131979790 CCTTGGATGGGTTCTGTCTACTA 0: 1
1: 0
2: 0
3: 14
4: 94
Right 1061643536 9:131979812-131979834 AGTGGCACCTGAAAACAAGATGG No data
1061643532_1061643537 25 Left 1061643532 9:131979768-131979790 CCTTGGATGGGTTCTGTCTACTA 0: 1
1: 0
2: 0
3: 14
4: 94
Right 1061643537 9:131979816-131979838 GCACCTGAAAACAAGATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061643532 Original CRISPR TAGTAGACAGAACCCATCCA AGG (reversed) Intronic
905023102 1:34831364-34831386 CAAGAGACCGAACCCATCCATGG + Intronic
916571894 1:166035366-166035388 TAGTAAAAAGAACGCAGCCATGG - Intergenic
918739332 1:188107271-188107293 AATAAGACAGAACCCCTCCAAGG - Intergenic
919957234 1:202430543-202430565 TAGATGACAGAATTCATCCAAGG - Intronic
921093657 1:211867905-211867927 TAGTAGACTGGACACAGCCAAGG - Intergenic
923978721 1:239295776-239295798 TAGCTGACAGAACCCATCTGAGG - Intergenic
924097042 1:240563577-240563599 TAGTCAACGGCACCCATCCATGG + Intronic
924428001 1:243971488-243971510 TAGGACACAGAACACATCCACGG + Intergenic
924891617 1:248288061-248288083 CAGGAGACAGAAACCATCCTGGG + Intergenic
1062833241 10:619850-619872 AAGTACAGGGAACCCATCCACGG - Intronic
1066976079 10:42368787-42368809 TAGGAGACAGTGCCCATACAGGG + Intergenic
1068949582 10:62763530-62763552 TGGTAGACAGAACCTAGGCAAGG + Intergenic
1073044945 10:100631578-100631600 AAGTAGACAGAACCCTGCCAAGG + Intergenic
1076170099 10:128312048-128312070 AAGTAGACAGAAACCATCCGGGG + Intergenic
1076296379 10:129388367-129388389 TGGTGGACAGCACCTATCCAAGG - Intergenic
1079099765 11:17533867-17533889 TAGTGGACAGAACCCAGCTAAGG - Intronic
1083642625 11:64153628-64153650 TAGATGACAGAACTCATGCAAGG + Intronic
1084242037 11:67828272-67828294 TAGGAGACAGAGCTCAGCCAGGG + Intergenic
1085251414 11:75146402-75146424 AACTGGCCAGAACCCATCCATGG - Intronic
1085979340 11:81704397-81704419 TAGTAGACTAGACCCAGCCAAGG - Intergenic
1086250448 11:84806057-84806079 TCATTTACAGAACCCATCCATGG - Intronic
1090374303 11:126278018-126278040 TAGCAGACAGAGCCCAGGCATGG + Exonic
1095412582 12:41940221-41940243 TTCTAGCTAGAACCCATCCATGG + Intergenic
1101318990 12:103656408-103656430 GTGTAGACAGAAACCATCCATGG + Intronic
1105944222 13:25176065-25176087 TAGGAGAAAGAGCCCATCCCAGG + Intergenic
1112339305 13:98539177-98539199 TAGCAGGCTGAACCCACCCATGG - Intronic
1114348222 14:21820470-21820492 TAGTAGACGGGACACAGCCAAGG - Intergenic
1117064615 14:51999116-51999138 TAGTACATAGATCCCCTCCATGG - Intronic
1125531360 15:40415563-40415585 GAGGAGACAGTAACCATCCACGG - Intronic
1129969504 15:79765531-79765553 TAGTAGACACAACACAGCCAAGG - Intergenic
1135267601 16:21040961-21040983 TAGTAGAAAGCACCCAGGCATGG - Intronic
1140099540 16:71903841-71903863 TAGCAGACAGAACACAAACAAGG - Intronic
1140211173 16:72971812-72971834 CATAAGACAGAACCCATCTATGG + Intronic
1147950656 17:44105869-44105891 GAGTAGACTGAGCCCATCCTTGG - Intronic
1147960740 17:44166148-44166170 TAGGAGACAGAGGCCTTCCATGG + Intergenic
1150356497 17:64490408-64490430 CAGCAGACAGATCCCAGCCAAGG + Intronic
1155202906 18:23533186-23533208 TAAAAGAAAAAACCCATCCAGGG - Intronic
1155402240 18:25451495-25451517 TAGTAGAGTGAACACAGCCAAGG + Intergenic
1157081106 18:44526244-44526266 TAGTAGACAGAACACTTACGCGG - Intergenic
1157124445 18:44942705-44942727 TAGTAGACGTAACCTTTCCATGG - Intronic
1157722307 18:49934671-49934693 TGGTAAACAGAAGCCACCCAGGG + Intronic
1158430479 18:57381210-57381232 CAGTAGACTGAACACAGCCAAGG + Intergenic
1163220043 19:15912074-15912096 CAGTAGACACAACCCAGCCGAGG + Intergenic
1164824469 19:31274363-31274385 GAGGAGACTGAACCCATCCATGG - Intergenic
1165220221 19:34310345-34310367 TAGGACACATAACCCATACATGG - Intronic
1165773886 19:38393935-38393957 TTGCAGACAGTTCCCATCCATGG + Intronic
926838333 2:17049564-17049586 CAACAGACAGAACTCATCCATGG + Intergenic
927589454 2:24340620-24340642 TAGCAGACAGAACGAATCTATGG - Intronic
935382358 2:102465496-102465518 CAGTAGGCAGGACCTATCCATGG - Intergenic
936745746 2:115574405-115574427 AAGTAGAGAGAACCAAGCCATGG - Intronic
937020008 2:118641514-118641536 TTGTGGACAGAACCCACCCATGG + Intergenic
939791232 2:146579724-146579746 TAGTAGAGATAACCCATGAAGGG - Intergenic
940189033 2:151018903-151018925 TAGTAGAAAGATACCATCAAGGG - Intronic
941012581 2:160317981-160318003 TTGTAGCCAAAACCCAACCAGGG + Intronic
943437083 2:187879207-187879229 CAGTAGACATAACACAGCCAAGG + Intergenic
944902148 2:204226423-204226445 TAGGAGGCAGAATCAATCCAAGG - Intergenic
945304484 2:208246001-208246023 TAGTAGAAATAATGCATCCAGGG + Intronic
946350415 2:219147535-219147557 TAGTATTCAGCACCCATCCTGGG + Intronic
947851221 2:233289830-233289852 TAGGAGAGAGAACACAGCCAGGG - Intronic
1175900935 20:62359693-62359715 TTGGAGAGAGAACCCCTCCACGG + Intronic
1178288784 21:31348743-31348765 GAATAGAAAGACCCCATCCAGGG - Intronic
1182443695 22:30378305-30378327 TATAAGACAGAACCCAACCATGG + Intronic
1183744650 22:39685654-39685676 CAGCAGGCAGACCCCATCCAAGG - Intronic
951698311 3:25468790-25468812 TAGCAGGCAGAACCCACACATGG + Intronic
954953962 3:54502385-54502407 TAGTAGACTGAACACAGCCAAGG - Intronic
954954259 3:54505331-54505353 AAGTAGACAGGTCCCATCCTTGG - Intronic
956187826 3:66579308-66579330 CATTAGACATAACCCTTCCAAGG - Intergenic
957057495 3:75455194-75455216 TAGGAGACAGAGCTCAGCCAGGG + Intergenic
962301636 3:134248966-134248988 TAGGAGACAGAAGACAACCAGGG - Intronic
963293628 3:143520117-143520139 TAGAAAACAGAAGTCATCCAAGG + Intronic
964925893 3:161956457-161956479 AAGGAGACAGAAACCAGCCAAGG - Intergenic
970170300 4:13282576-13282598 TAGTACAGAAAACCCTTCCAGGG - Intergenic
971004175 4:22355832-22355854 AAGTAGACAGAAACCAACAAGGG + Intronic
973807790 4:54542134-54542156 TAGAAGACAGAACAAATACAGGG + Intergenic
975748001 4:77493466-77493488 TGGCAGACAGAAGGCATCCAAGG + Intergenic
976168176 4:82276683-82276705 TAATAGACAGCATCCATCCCTGG + Intergenic
977493754 4:97747880-97747902 TATTAAACAGAACACATCAAAGG - Intronic
981761276 4:148198003-148198025 TAGAAGACAGAAAGCTTCCAAGG + Intronic
984237623 4:177179842-177179864 TAGTAGACAGAAGAGATACATGG + Intergenic
991516280 5:67439102-67439124 TGGTAGACAGAGCTCCTCCAAGG - Intergenic
992575616 5:78107668-78107690 TAGAAGACAGCTGCCATCCACGG - Intronic
999690800 5:154144369-154144391 TATTAGAGAGCACCCATGCATGG - Intronic
1008006115 6:46411111-46411133 TAGTATACAGAGCCCATACAGGG + Intronic
1008567221 6:52781203-52781225 TACCAGACAGAAGCCATTCAAGG - Intergenic
1012442866 6:99277773-99277795 TAATAGAAAGAAACCATCAAGGG + Exonic
1013790342 6:113829306-113829328 TTGTAGCCAGAATCCATCCCCGG + Intergenic
1014682320 6:124447030-124447052 CAGTAGAAAAAAGCCATCCAGGG - Intronic
1017786940 6:157764168-157764190 TACTAGACAGAGCACAGCCATGG - Intronic
1021016718 7:15544425-15544447 TATTAGTCAGAACCCAAACAAGG - Intronic
1024942716 7:54778873-54778895 TTGTTGCCAAAACCCATCCAGGG - Intergenic
1028825686 7:95270980-95271002 TGGTAAACAAAACCTATCCAAGG + Intronic
1030477525 7:110055459-110055481 AAGCAGACAGAACCCTTCCATGG + Intergenic
1034461143 7:151198696-151198718 TAGAAGGCAGAACCCATGCAGGG + Intronic
1036662834 8:10718979-10719001 TAGATGACAGAACCGGTCCAGGG + Intergenic
1042150897 8:65782657-65782679 TAGTAGAAATAACCTATTCATGG - Intronic
1045510346 8:102808087-102808109 CATTAGACAGCAGCCATCCAAGG - Intergenic
1046345420 8:112918671-112918693 TTGTATACATAACCCATCTATGG + Intronic
1050109840 9:2203032-2203054 TAGTAGACTGGACACAGCCAAGG + Intergenic
1051516252 9:17933465-17933487 TATTATGCAGAATCCATCCATGG - Intergenic
1051591358 9:18779217-18779239 GAGTAGACAGAACTCTTCCTTGG - Intronic
1053398698 9:37799423-37799445 CAGTAGATTGGACCCATCCAGGG + Intronic
1059970267 9:119660127-119660149 TAGGAGACACAACACCTCCAGGG + Intergenic
1061499181 9:130992407-130992429 AAGTCAGCAGAACCCATCCAGGG - Intergenic
1061643532 9:131979768-131979790 TAGTAGACAGAACCCATCCAAGG - Intronic
1203486348 Un_GL000224v1:59255-59277 TAGTAGACTGAACACAACAAAGG - Intergenic
1203498969 Un_KI270741v1:1154-1176 TAGTAGACTGAACACAACAAAGG - Intergenic
1186758564 X:12699546-12699568 TTGTATGCAGAAGCCATCCAGGG + Intronic
1190113598 X:47611097-47611119 TAGTTGTCAGAACCCCTACATGG + Intronic
1202576633 Y:26333969-26333991 TAGATGACAGAACTCATCCAAGG + Intergenic