ID: 1061643534

View in Genome Browser
Species Human (GRCh38)
Location 9:131979794-131979816
Sequence CATGCTAACTCCTTGTAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061643528_1061643534 18 Left 1061643528 9:131979753-131979775 CCAAAATATTCCTTACCTTGGAT 0: 1
1: 0
2: 2
3: 8
4: 217
Right 1061643534 9:131979794-131979816 CATGCTAACTCCTTGTAGAGTGG No data
1061643531_1061643534 8 Left 1061643531 9:131979763-131979785 CCTTACCTTGGATGGGTTCTGTC 0: 1
1: 0
2: 1
3: 7
4: 114
Right 1061643534 9:131979794-131979816 CATGCTAACTCCTTGTAGAGTGG No data
1061643526_1061643534 27 Left 1061643526 9:131979744-131979766 CCACTTATGCCAAAATATTCCTT 0: 1
1: 0
2: 3
3: 26
4: 711
Right 1061643534 9:131979794-131979816 CATGCTAACTCCTTGTAGAGTGG No data
1061643532_1061643534 3 Left 1061643532 9:131979768-131979790 CCTTGGATGGGTTCTGTCTACTA 0: 1
1: 0
2: 0
3: 14
4: 94
Right 1061643534 9:131979794-131979816 CATGCTAACTCCTTGTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061643534 Original CRISPR CATGCTAACTCCTTGTAGAG TGG Intronic
No off target data available for this crispr