ID: 1061645103

View in Genome Browser
Species Human (GRCh38)
Location 9:131994796-131994818
Sequence GGCCACTGGGACTACTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061645103_1061645114 8 Left 1061645103 9:131994796-131994818 CCATCACAGTAGTCCCAGTGGCC 0: 1
1: 0
2: 2
3: 14
4: 142
Right 1061645114 9:131994827-131994849 CTCATGCCTGTGGTTGCCTGGGG No data
1061645103_1061645118 29 Left 1061645103 9:131994796-131994818 CCATCACAGTAGTCCCAGTGGCC 0: 1
1: 0
2: 2
3: 14
4: 142
Right 1061645118 9:131994848-131994870 GGGAATCCTACACGAGCATACGG No data
1061645103_1061645113 7 Left 1061645103 9:131994796-131994818 CCATCACAGTAGTCCCAGTGGCC 0: 1
1: 0
2: 2
3: 14
4: 142
Right 1061645113 9:131994826-131994848 GCTCATGCCTGTGGTTGCCTGGG No data
1061645103_1061645107 -2 Left 1061645103 9:131994796-131994818 CCATCACAGTAGTCCCAGTGGCC 0: 1
1: 0
2: 2
3: 14
4: 142
Right 1061645107 9:131994817-131994839 CCCTCCCCAGCTCATGCCTGTGG No data
1061645103_1061645115 9 Left 1061645103 9:131994796-131994818 CCATCACAGTAGTCCCAGTGGCC 0: 1
1: 0
2: 2
3: 14
4: 142
Right 1061645115 9:131994828-131994850 TCATGCCTGTGGTTGCCTGGGGG No data
1061645103_1061645112 6 Left 1061645103 9:131994796-131994818 CCATCACAGTAGTCCCAGTGGCC 0: 1
1: 0
2: 2
3: 14
4: 142
Right 1061645112 9:131994825-131994847 AGCTCATGCCTGTGGTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061645103 Original CRISPR GGCCACTGGGACTACTGTGA TGG (reversed) Intronic
900823962 1:4911551-4911573 GGCCACAGGGGCTGCTGTGTTGG + Intergenic
902785887 1:18732414-18732436 AGGCACTGGGACTACAGAGACGG + Intronic
905028971 1:34868865-34868887 GGCCAGTGGGCCTACCGCGAGGG - Exonic
905781003 1:40709269-40709291 AGCCAATGGGACCACTGTGGAGG + Intronic
906247973 1:44290378-44290400 TGCCACAGGGACACCTGTGAGGG + Intronic
906666103 1:47623175-47623197 GTCCACTCAGACTCCTGTGAAGG - Intergenic
906690047 1:47786527-47786549 GGCAACTGGCATTCCTGTGAAGG - Intronic
910423805 1:87099662-87099684 AGACTTTGGGACTACTGTGAAGG - Intronic
912697082 1:111849621-111849643 GGCCACTGGTACAACTGTGCAGG + Intronic
920695160 1:208176223-208176245 GGCCACTGGGACCCCTCTGCAGG - Intronic
922895664 1:229098140-229098162 GGCCACTGAGTCCTCTGTGAAGG + Intergenic
1066073529 10:31847542-31847564 GGCCACTGGGAGTAGTGTCTAGG + Intronic
1070772299 10:79089533-79089555 GGGTACTGGGACTGCTGTGTTGG + Intronic
1071387653 10:85138611-85138633 AGCCACCTGGTCTACTGTGATGG - Intergenic
1073860378 10:107732019-107732041 TGCCACTGCCACCACTGTGAAGG - Intergenic
1075038706 10:119090524-119090546 TGCCACTGGGAGTCCTTTGAAGG + Intergenic
1076924495 10:133475632-133475654 GGCAAATGGGGCTCCTGTGATGG + Intergenic
1078057505 11:8019591-8019613 GGCCACTGGGACTAGCGAGCTGG + Intronic
1081962830 11:47150861-47150883 GGGCAATGGGAAGACTGTGAAGG + Intronic
1083164191 11:60873527-60873549 GGCCACTGGGGCTGCTGGAAGGG - Exonic
1083593941 11:63910156-63910178 GGCCACTGGGCACTCTGTGATGG + Exonic
1088430547 11:109753851-109753873 GGCCACTGGAGAAACTGTGAAGG + Intergenic
1091520635 12:1237568-1237590 CTCCACTTGGATTACTGTGAAGG - Intronic
1091582072 12:1796277-1796299 GGCCGCTGGGACTGCTGGGAAGG - Intronic
1095570226 12:43675717-43675739 GGCCACTGGGACAACCGTCCAGG - Intergenic
1096808669 12:54155984-54156006 AGCCACTGGGGCTGATGTGAAGG + Intergenic
1097730459 12:63123098-63123120 GGCATCTCGGAGTACTGTGAAGG + Intergenic
1101030026 12:100649171-100649193 GGTCATTGAGACCACTGTGATGG + Intergenic
1102576736 12:113860482-113860504 GCCCACTGGGACTACAGGGATGG + Intronic
1104255008 12:127128287-127128309 GGCCTCTGGGACTTCAGTCAAGG + Intergenic
1104558229 12:129821443-129821465 GGCCAATGGAACTACTTTGAAGG + Intronic
1113016692 13:105835884-105835906 GGCCACTAGGCCTCCTGTGATGG + Intergenic
1115376412 14:32681805-32681827 AGTCACTGGGACTACTGGGGTGG + Intronic
1115669078 14:35588331-35588353 GGCCCTTGTGACTACTTTGAGGG + Intronic
1116424978 14:44780103-44780125 AGCCACTGGGGCTACCGTCAAGG - Intergenic
1118694217 14:68368577-68368599 GGCCGCTTGGACTGCTGTAATGG + Intronic
1119618515 14:76114212-76114234 GGCCACTGGGCCATCTGTGATGG - Intergenic
1125835388 15:42746070-42746092 AGGCACTGGGACTCCTGCGAGGG + Exonic
1128054743 15:64691303-64691325 GGCCAGTGGGGGGACTGTGAAGG - Intronic
1129882730 15:79017815-79017837 GGCCACTAGGATGACTGTAAAGG + Exonic
1130030422 15:80308614-80308636 GCCCACTGGGGCCACAGTGATGG + Intergenic
1130287456 15:82567810-82567832 GGTGACTGAGACTACTGTGGGGG - Intronic
1131032134 15:89195268-89195290 GGCCACTTGGGCTTCTTTGAGGG + Exonic
1131405785 15:92163374-92163396 GGCCACAGAGTCTACTTTGAAGG + Exonic
1133073716 16:3264021-3264043 GGCGACTGGCACGACTGTCAGGG + Intronic
1133921064 16:10153769-10153791 TGCCACTTGGACAACTGAGACGG + Intronic
1135187592 16:20328623-20328645 GGCCACTGGGGAGACTGGGATGG - Intergenic
1136548947 16:30971600-30971622 GGGCACTGGGACTTCTCTGGGGG - Exonic
1137725755 16:50655501-50655523 ACCCACTGGGATAACTGTGAGGG + Intergenic
1141639531 16:85333332-85333354 GGCCTCTGGGGCTGCTGGGAGGG - Intergenic
1144169984 17:12650060-12650082 GGTCACTGGGACCACAGGGAGGG + Intergenic
1144726485 17:17505006-17505028 TGCCACTGGGACTCCTGAGGTGG - Intergenic
1146821290 17:35985154-35985176 GGCCTCAGGGACTATTGTGGAGG + Intronic
1148047511 17:44753206-44753228 GGCCACTTGGACGCCTGAGAGGG + Intergenic
1152622690 17:81373083-81373105 GGCCACTGGGCCTTCAGTGGGGG - Intergenic
1152984685 18:311097-311119 GGGCCCTGGGAAGACTGTGAAGG - Intergenic
1153387241 18:4511326-4511348 GGCCAGTGGGAGAACTGGGAAGG - Intergenic
1155240705 18:23861449-23861471 TGCCACTGGGAGTTCTGGGAAGG - Intronic
1157110290 18:44814131-44814153 GGCCAGTGGGAGTAGGGTGATGG + Intronic
1157487258 18:48096976-48096998 GGCCACTGCTACTACTATCAAGG + Intronic
1160542776 18:79634283-79634305 GGTCACTGGGAGTGCTGTGCAGG - Intergenic
1162451167 19:10756112-10756134 GTCCACTGTGACTACTGTGACGG + Intronic
1162789169 19:13054191-13054213 GGCCACTGGGCCTTCGGTGGGGG + Intronic
928794549 2:35000990-35001012 GGTGACTGTGACTACTGTAATGG - Intergenic
929888380 2:45898839-45898861 GATCACAGGGACTTCTGTGAAGG + Intronic
931785058 2:65611065-65611087 GGCCACTGGGGCCAGTGTGGAGG - Intergenic
933255212 2:80072798-80072820 GGCCACTGAGAAACCTGTGATGG + Intronic
935442923 2:103123012-103123034 GCCTCCTGGGCCTACTGTGAAGG - Intergenic
938954354 2:136284271-136284293 GGGCACTTGGACTCCTGTGCTGG - Intergenic
947744571 2:232500908-232500930 GGCCACTGGGACATCTGGGAAGG + Intergenic
1169141578 20:3229947-3229969 AGGCACTGGGCCGACTGTGATGG - Intronic
1170478948 20:16745879-16745901 GGCCACTGGGGGTTCAGTGAGGG - Intergenic
1171254091 20:23673238-23673260 GGCCACTGATACCATTGTGAGGG + Intergenic
1171521833 20:25782036-25782058 GGTTCCTGGAACTACTGTGAGGG - Intronic
1171554992 20:26073847-26073869 GGTTCCTGGAACTACTGTGAGGG + Intergenic
1173769863 20:45647306-45647328 GGCACCTGGGACTATTGAGATGG + Intergenic
1175804596 20:61820539-61820561 GTGCAGTGGGACTGCTGTGAGGG - Intronic
1177892946 21:26828026-26828048 GGCAGCTGGGACTAGGGTGATGG + Intergenic
1178086076 21:29113401-29113423 GGCCTCTGGGAGAACAGTGAAGG - Intronic
1178623373 21:34195693-34195715 GGCCACTGGGACTCCAGAGCAGG - Intergenic
1179047941 21:37863304-37863326 AGCCATTGGGGCTACTGTGTTGG - Intronic
1182967117 22:34532725-34532747 GGGCAGGGGGACTACAGTGAGGG - Intergenic
1184243325 22:43222904-43222926 GCCCACTGGGTTTACTGAGAAGG + Intronic
952325279 3:32314979-32315001 GGAAACAGGGACAACTGTGATGG - Intronic
953392331 3:42540804-42540826 GGCCACTCTGGCTACTGAGAAGG + Intergenic
955204582 3:56884288-56884310 GGGCTCTGGGAGGACTGTGAGGG + Intronic
956623312 3:71242688-71242710 GTCCTCTGAGACAACTGTGAGGG + Intronic
966776406 3:183546430-183546452 AGCCACTGGCACTGCTGTCAGGG - Intronic
967754562 3:193154606-193154628 GGCCAGTGGGACTCCTGTTTAGG - Intergenic
968540368 4:1165270-1165292 GGCCCCAGAGACTTCTGTGATGG + Intergenic
968540379 4:1165317-1165339 GGCCCCAGAGACTTCTGTGATGG + Intergenic
968888604 4:3353174-3353196 GCCCTCTGGGACTACTTTGCTGG + Intronic
969050427 4:4369107-4369129 GGAAACTGGGACTTCCGTGATGG + Intronic
970389532 4:15593733-15593755 GGACGCTGGGTATACTGTGAAGG - Intronic
971440982 4:26685191-26685213 GGCCACTGGGGCTACTGTTAAGG + Intronic
971758548 4:30734695-30734717 GGGCACTGGAAATACTGTGATGG - Intronic
981133094 4:141180341-141180363 GGAAACTGGGACTCCTTTGAGGG - Intronic
982090861 4:151878977-151878999 GGCCACTGGATCTCCTGGGATGG - Intergenic
982141305 4:152322105-152322127 GGCCACTGGGAGTACAGTACAGG + Exonic
985543397 5:497451-497473 GGGCACCGGGACTGCTGTGAAGG + Intronic
986150968 5:5130146-5130168 GGCCACTGTGGCTACTATAAAGG + Intergenic
986353637 5:6903499-6903521 GGCAACAGGGACCACTGGGATGG + Intergenic
987157765 5:15108088-15108110 GGACACTGGAACTACTTTAAAGG - Intergenic
987952740 5:24696623-24696645 GGCCACTGGAACTAGTATGAAGG + Intergenic
989609162 5:43274759-43274781 GTCCACTGGGACTTCTGGAATGG - Intronic
992927078 5:81599150-81599172 TGCCAGTGGGACCACTGGGAAGG + Intronic
994212152 5:97099291-97099313 AGCCACTGGGGCCACTTTGATGG - Intronic
995747968 5:115423752-115423774 AGGCTCTGGGACCACTGTGAGGG - Intergenic
999050852 5:148522631-148522653 GGTTATAGGGACTACTGTGATGG + Intronic
1000175305 5:158746428-158746450 GGCCACTGGGCCTACTTTTGGGG - Intronic
1002947970 6:1780741-1780763 AGGCACTAGGACTCCTGTGATGG - Intronic
1003931839 6:10931453-10931475 GGCCACTGCCACTACTGGGAGGG - Exonic
1005722259 6:28614858-28614880 GGCCACTGGGTTGACTGAGATGG - Intronic
1006012812 6:31056624-31056646 GGTCCCTGGGTCTACAGTGATGG - Intergenic
1006091763 6:31632539-31632561 GGCCACTGTGACTGTTGTGAGGG - Exonic
1006132590 6:31878213-31878235 GGCCCCTGGGGTTCCTGTGAAGG - Intronic
1006466062 6:34195738-34195760 AGCCCCTGGCACTGCTGTGAGGG + Intergenic
1007113331 6:39326357-39326379 GGCCACAGGGACGTCTGAGATGG + Intergenic
1007651013 6:43421728-43421750 GGCCACTGGGCCTGGTGCGATGG - Intergenic
1011182238 6:84633986-84634008 GTCCACTGGGACCACAGTGCAGG - Intergenic
1011574781 6:88784384-88784406 GGCCAATGGGAATACTGTGGAGG + Intronic
1012055866 6:94409279-94409301 AGACAGTGGGACTACTGGGAGGG + Intergenic
1014705502 6:124741653-124741675 GGCTACTGTGATTATTGTGATGG + Intronic
1016540407 6:145158037-145158059 GTCCACTTGGACTTCTGTAATGG - Intergenic
1017696241 6:157019181-157019203 GGACACTGGGGGCACTGTGAGGG + Intronic
1021579501 7:22138158-22138180 TGCCACTGGGACATTTGTGAGGG - Intronic
1023391819 7:39718245-39718267 AGCCAGAGGGAATACTGTGAAGG - Intergenic
1025282321 7:57637111-57637133 GGTTCCTGGAACTACTGTGAGGG - Intergenic
1025302409 7:57828408-57828430 GGTTCCTGGAACTACTGTGAGGG + Intergenic
1029792589 7:102860499-102860521 GGTCACTGGGAGTAGTGGGAGGG + Intronic
1036780560 8:11644074-11644096 GCCTCCTGGGACTGCTGTGAAGG - Intergenic
1037148656 8:15607280-15607302 GGTCACTGGGCATACAGTGATGG + Intronic
1037754104 8:21700397-21700419 GGCCACAGGGCCAACTGGGAGGG + Intronic
1038599946 8:28930023-28930045 GGGCACTGGGCCTAATGTCAGGG + Intronic
1040111437 8:43568699-43568721 GGGCACTGGGGCTACTGGAAAGG + Intergenic
1040335912 8:46415872-46415894 GGCCATGGGGACTTCTGTGTTGG - Intergenic
1041476073 8:58267653-58267675 AGACACTGGGACTACTGGGGAGG - Intergenic
1042110239 8:65374005-65374027 AGACACTGGGACTACTGGGCAGG + Intergenic
1042427719 8:68668455-68668477 GGACACTGGGACAACTGACATGG + Intronic
1045809319 8:106202603-106202625 CCCCACTGAGACTACTGTGAAGG - Intergenic
1047965799 8:130045784-130045806 GGCCACTGGGACTAGTTGGTGGG + Intergenic
1049181874 8:141227052-141227074 TGCCACTGGGACGGCTCTGACGG + Intronic
1053412447 9:37924499-37924521 GGCCTTTGGGACTAATGTGTGGG + Intronic
1054821647 9:69527466-69527488 TCCCACTGGGACTGTTGTGAGGG - Intronic
1059318113 9:113444655-113444677 GGCCACTAGGTCTGTTGTGAAGG - Intergenic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1061014167 9:127972361-127972383 GGCCGCTGGCACTCCTGTGTGGG - Intronic
1061645103 9:131994796-131994818 GGCCACTGGGACTACTGTGATGG - Intronic
1188545921 X:31306993-31307015 GGCCACGGCAACTACTGTAAGGG + Intronic
1189797922 X:44663574-44663596 GGCCACTGTAGCTACTGGGATGG - Intergenic
1190320770 X:49178010-49178032 CGCCACGCGGAGTACTGTGATGG - Exonic
1193141234 X:78029351-78029373 GGCCACTCCAACTGCTGTGATGG + Exonic
1193320064 X:80111236-80111258 GGCACCTGGGAATACTGAGATGG - Intergenic
1193347640 X:80422906-80422928 GGTTACTGGGTTTACTGTGAGGG + Intronic
1193724368 X:85021582-85021604 GGCACCTGGGACCACTGGGATGG - Intronic
1194938985 X:99986723-99986745 TACCACTGGGAGTGCTGTGAGGG - Intergenic
1197503235 X:127267418-127267440 AGCCACTGGGACTAATTTGCAGG + Intergenic
1197689009 X:129477141-129477163 GGCCACTTGGACTGCAGTGGTGG - Intronic
1200204424 X:154305573-154305595 GGCCACTTGGAGCCCTGTGATGG + Intronic