ID: 1061645385

View in Genome Browser
Species Human (GRCh38)
Location 9:131996751-131996773
Sequence TAGAGTAAGGAGGAGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 869
Summary {0: 1, 1: 0, 2: 5, 3: 75, 4: 788}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061645385_1061645390 -2 Left 1061645385 9:131996751-131996773 CCAACCTCCTCCTCCTTACTCTA 0: 1
1: 0
2: 5
3: 75
4: 788
Right 1061645390 9:131996772-131996794 TACTCAACATGAAGACCATGAGG 0: 4
1: 29
2: 136
3: 290
4: 479
1061645385_1061645392 16 Left 1061645385 9:131996751-131996773 CCAACCTCCTCCTCCTTACTCTA 0: 1
1: 0
2: 5
3: 75
4: 788
Right 1061645392 9:131996790-131996812 TGAGGATGAAGACCTTTATGAGG 0: 5
1: 4
2: 12
3: 41
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061645385 Original CRISPR TAGAGTAAGGAGGAGGAGGT TGG (reversed) Intronic
900149080 1:1170494-1170516 GAGAGGAAGGAGGAGGGGGAGGG - Intergenic
900620042 1:3582518-3582540 TAGAGTGAGCAGGAGAAGCTGGG - Intronic
900702816 1:4058684-4058706 TGGAGGGAGGAGGAGGAGGGCGG + Intergenic
900725553 1:4214191-4214213 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
900883879 1:5401923-5401945 TAGAGTGAGGACGGGGAGGCGGG - Intergenic
901122261 1:6905489-6905511 TAAAGAAAGGAGGAGCAGGCCGG - Intronic
901276146 1:7992487-7992509 TGGGGAAAGGAAGAGGAGGTAGG - Intergenic
901644011 1:10706958-10706980 GAGAGGATGGAGGAGGAGGCCGG + Intronic
901740366 1:11338131-11338153 AAGGGGGAGGAGGAGGAGGTGGG - Intergenic
901755204 1:11437299-11437321 CAGAGTAAGGTGGAAGAGGCAGG - Intergenic
901863370 1:12088758-12088780 AACAGGAAGGAGGAGGAGGAGGG + Intronic
902376781 1:16033582-16033604 CAGAGAAAGGGGGTGGAGGTGGG - Intronic
902570899 1:17346526-17346548 CAGACTAAGCAGGAGGAGATGGG - Intronic
902757702 1:18559931-18559953 TGGAGGAAGGAAGAGAAGGTGGG + Intergenic
902782534 1:18713791-18713813 TAAAGGAAGGGGTAGGAGGTTGG + Intronic
902841247 1:19075339-19075361 TAGTGAGAGGAGGAGGAGGTGGG - Intronic
903217733 1:21852469-21852491 TGGAGAGAGGAAGAGGAGGTGGG + Intronic
903522292 1:23959833-23959855 TAGAGGCAGAAGGAGAAGGTCGG + Exonic
903554481 1:24183473-24183495 GAGAGTAAGGAGGCTGAGGTGGG + Intronic
903776507 1:25797531-25797553 AAGAGGGAGGAGGAGGAGGCAGG - Intergenic
903989195 1:27253425-27253447 AGGAGGAAGGAGGAGGAGGGAGG - Intronic
903989199 1:27253435-27253457 AAGAGGAAGGAGGAGGAAGGAGG - Intronic
904024946 1:27496934-27496956 CAGATTAAGGATGTGGAGGTGGG - Intergenic
904047568 1:27617747-27617769 AAGAGTTTGGAGGTGGAGGTGGG - Intronic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
905068097 1:35200943-35200965 TAGACTCAGGAGGCTGAGGTGGG - Intergenic
905543062 1:38775467-38775489 TAGGGTAAAGAAGAGGAGGAAGG - Intergenic
905791009 1:40789533-40789555 GAGTGCAAGGAGGAGGAGGAAGG - Intronic
906024171 1:42658717-42658739 TAGACTAGGGAGGCGGAGGTGGG + Intronic
906405842 1:45541238-45541260 TATAGTCAGGAGGCTGAGGTGGG + Intergenic
906748104 1:48235623-48235645 TAGAGTCAGGAGCTGGGGGTGGG - Intronic
907461158 1:54606397-54606419 GGGAGTGGGGAGGAGGAGGTGGG + Intronic
907476956 1:54712276-54712298 TAGGGTAAGGAGGAGGGCTTTGG + Intronic
907592568 1:55689836-55689858 CAGAGCATGGATGAGGAGGTGGG + Intergenic
907703223 1:56810018-56810040 GAGAGAAAGAAGGAGGAGGAAGG + Intronic
907997150 1:59644395-59644417 TAAAGAGAGGTGGAGGAGGTGGG + Intronic
908131731 1:61081959-61081981 TAGAGAACCGAGGAGGAGGCCGG - Exonic
908349165 1:63267111-63267133 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
909142555 1:71887229-71887251 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
909748427 1:79128274-79128296 TCGAGTTAGGAGGAGGGGGATGG - Intergenic
910549848 1:88463205-88463227 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
912077778 1:105898270-105898292 TAGAGGAAGCTGGAGGAGGGAGG - Intergenic
913012815 1:114701374-114701396 TCAAGGAAGGAGGAGGAGGTAGG - Intergenic
913343021 1:117778874-117778896 TAGAGGCAGAAGGAGAAGGTCGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914353404 1:146860142-146860164 TAGACAAAGGCGGAAGAGGTTGG + Intergenic
914506824 1:148296574-148296596 AGGAGGAGGGAGGAGGAGGTGGG - Intergenic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915272581 1:154765737-154765759 TAGACTCAGGAGGCTGAGGTGGG - Intronic
915323715 1:155070012-155070034 TATAAGGAGGAGGAGGAGGTGGG + Intergenic
915369646 1:155337785-155337807 TGGAATAAGGAGTAGGAGATTGG - Intronic
915824779 1:159063868-159063890 TAGACTGAGGAGGAAGAGGAGGG - Intronic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916149335 1:161771206-161771228 AGGAGAAAGGAGGAGGAGGAGGG - Intronic
916738714 1:167630208-167630230 ACGAGGAAGGAGGAGGAGGGAGG - Exonic
917952855 1:180058558-180058580 GAGAGGAAGGAGGAAGAGATTGG + Intronic
917963576 1:180164912-180164934 GAGAGGAAGCAGGAGGGGGTTGG + Intronic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
918371364 1:183864761-183864783 TAGAGAAAGGAGCAGGTGGATGG + Intronic
919759361 1:201087681-201087703 GAGAGAAGGGAGGAGGAGGAAGG - Intronic
920092426 1:203464124-203464146 GGGAGGAAGGAGGAGGAGGAGGG + Intergenic
920122449 1:203668881-203668903 TAGATTGGGGAGAAGGAGGTAGG + Intronic
920910933 1:210215683-210215705 TAGAGTAGGGAGGAGGAGGAGGG + Intergenic
921377257 1:214487257-214487279 TGAAGGAAGGAGGAGGAGGCAGG + Intronic
921912140 1:220561105-220561127 CTGAGTAAGGAGGTGTAGGTAGG + Intronic
922375437 1:224959271-224959293 TGGGGTAATGAGGAGGAGGGTGG - Intronic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922867873 1:228875940-228875962 AATAATAAGGAGGAGGAGGGAGG - Intergenic
923006285 1:230052670-230052692 GAGAATAAGAAGGAAGAGGTCGG - Intergenic
923131529 1:231078844-231078866 TTAAAGAAGGAGGAGGAGGTCGG - Intergenic
923141036 1:231162022-231162044 GAGAGTAATGGGGAGGAGGGGGG - Intergenic
923237846 1:232051650-232051672 GAGACAGAGGAGGAGGAGGTAGG + Intergenic
923473790 1:234314341-234314363 TAGAGAACAGAGGAAGAGGTTGG + Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924680341 1:246224626-246224648 GAAAGGAAGGAGGAGGAGGAAGG + Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1063164813 10:3451676-3451698 TAGAGGAAAGAGGAGGAGGGAGG - Intergenic
1063312383 10:4965992-4966014 TACAATAATGAGGAGCAGGTTGG + Exonic
1063315551 10:5001581-5001603 TACAATAATGAGGAGCAGGTTGG - Exonic
1063325458 10:5096488-5096510 TACAATAATGAGGAGCAGGTTGG + Exonic
1063328642 10:5132669-5132691 TACAATAATGAGGAGCAGGTTGG - Intronic
1063334720 10:5200259-5200281 TACAATAATGAGGAGCAGGTTGG + Exonic
1063348057 10:5329623-5329645 TAGAGGAAGGGGAAGGGGGTTGG - Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1064016366 10:11775558-11775580 TAGAGTGAGGAGGTGCAGATGGG - Intergenic
1064927274 10:20582691-20582713 CAGAGAAAGTAGGAGGAGGGGGG - Intergenic
1064971041 10:21067465-21067487 AAGAGAAAGCAGGAGGAGGGAGG + Intronic
1065826448 10:29576654-29576676 GAGACTCAGGAGGATGAGGTGGG - Intronic
1066229584 10:33419402-33419424 GAGAGTTAGGAGGAGGAAGCTGG + Intergenic
1066408649 10:35144195-35144217 TATGGTAAGGAGGAGGAGTTGGG + Intronic
1067820418 10:49524089-49524111 GAGAAGGAGGAGGAGGAGGTCGG - Exonic
1068048158 10:51914030-51914052 TACAGTAAGAAAGAGGAGATTGG - Intronic
1069488014 10:68837374-68837396 TGGAGTATGGAGCGGGAGGTGGG + Intronic
1069595101 10:69665199-69665221 TAGAGGCTGGAGGAGGAGGAGGG + Intergenic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069821256 10:71230074-71230096 AAGAGCAGAGAGGAGGAGGTAGG - Intronic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1070205145 10:74251278-74251300 AAGAGAAAGGAGGAGGAGTAGGG + Intronic
1070385723 10:75922542-75922564 TAAGGTAAGGAGGAGAAGCTAGG - Intronic
1070664929 10:78336195-78336217 GGGAGTAAGGTGGAGGAGGGAGG + Intergenic
1070873873 10:79783356-79783378 TAAAATAATGAAGAGGAGGTGGG - Intergenic
1070882376 10:79861358-79861380 CAGAGGTAGGAGGAGGAGCTGGG - Intergenic
1071294178 10:84207250-84207272 GAGAGTGAGGAGGAGGAGAGGGG + Intronic
1071640805 10:87305495-87305517 TAAAATAATGAAGAGGAGGTGGG - Intergenic
1071648946 10:87377669-87377691 CAGAGGTAGGAGGAGGAGCTGGG - Intergenic
1071654431 10:87432441-87432463 TAAAATAATGAAGAGGAGGTGGG + Intergenic
1071746594 10:88426742-88426764 GACAGTAAGGAGGAGGAGCCAGG + Intronic
1072249814 10:93572621-93572643 CTGAGTGGGGAGGAGGAGGTGGG + Intronic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072443361 10:95477123-95477145 AAGGGAAAAGAGGAGGAGGTCGG - Intronic
1073026309 10:100489579-100489601 AAGAGTAAGTGGGAGGAGGGCGG + Intronic
1073131222 10:101190296-101190318 GTGGGTAGGGAGGAGGAGGTTGG + Intergenic
1073340916 10:102743993-102744015 GAGAGGGAGGAGGAGGAGGGAGG + Exonic
1073371659 10:102995189-102995211 AAGAGGAAGGAGGAGGAAGAGGG - Intronic
1073433279 10:103500654-103500676 AAGCGTAAGGGGGAGGAGGCTGG - Intronic
1073545018 10:104340372-104340394 GACAGTTTGGAGGAGGAGGTGGG - Intergenic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074853345 10:117456006-117456028 AAGAGCAAGCAGGAGGGGGTGGG + Intergenic
1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG + Intronic
1075334832 10:121601069-121601091 AAGAGAAAGGAGAAGGGGGTGGG + Intergenic
1075427602 10:122353944-122353966 AAGAGGAAGGAGGAGGAGCCAGG - Intergenic
1075518275 10:123127061-123127083 CAGAGTCAGGAGGAAGATGTGGG + Intergenic
1076332079 10:129677642-129677664 TAGAGCAGGGACGAGGAGGCAGG - Intronic
1076605055 10:131683823-131683845 TAGAGCCAGGAGTAGGAGGTGGG + Intergenic
1077145561 11:1042740-1042762 TAGAGTAAGCTGGGAGAGGTGGG + Intergenic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1077332535 11:1989779-1989801 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1077521735 11:3040061-3040083 TAGACTGAGGAGGAGAAGGGGGG - Intronic
1077535505 11:3122199-3122221 GAGAGGAAGTAGGAGGAAGTAGG + Intronic
1077862735 11:6197949-6197971 TAGAGTAAGGAGGCAGAGATGGG - Intergenic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078267642 11:9766790-9766812 TAGAGAAAGGATGACCAGGTGGG - Intergenic
1078309102 11:10220565-10220587 TAGGGTAAGAAACAGGAGGTAGG - Intronic
1078323860 11:10362053-10362075 GAGAGTGAGGAGGCTGAGGTGGG + Intronic
1078349838 11:10583542-10583564 TAAAGTAAAGAAGGGGAGGTTGG + Intronic
1078836140 11:15031877-15031899 TAGGCTGAGGAGGAGGAGGAAGG - Intronic
1079405304 11:20140143-20140165 AAGAGGGAGGAGGAGGAGGCGGG - Intergenic
1079512961 11:21232480-21232502 AAGAAAGAGGAGGAGGAGGTTGG + Intronic
1079661396 11:23041321-23041343 TAGAATGAGGATGAGGAAGTGGG - Intergenic
1079929944 11:26545790-26545812 TAGAGCAAGGAGGAAGAGGGAGG - Intronic
1080073335 11:28115724-28115746 TAGACTGAGGAAGAGGAGGAGGG + Intronic
1080159778 11:29159912-29159934 AAGAGAAAAGAGGAGGAGGATGG + Intergenic
1080237900 11:30092871-30092893 AGGAGGAAGGAGGAGGAGGGAGG - Intergenic
1080428867 11:32180198-32180220 TGCAGTAAAGAGGAGGAGGGAGG - Intergenic
1080648884 11:34207187-34207209 TGGAGAAAGGAGGAGGAGTCAGG - Intronic
1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG + Intergenic
1081514959 11:43819613-43819635 AAGAGGAAGGATGAAGAGGTGGG - Intronic
1081540546 11:44031571-44031593 GAGAGGGAGCAGGAGGAGGTGGG + Intergenic
1081573944 11:44308041-44308063 AAGAGGAAGGTGGAGGAAGTGGG + Intronic
1081606451 11:44530095-44530117 TAGAGGAAGGATGAGGATGATGG - Intergenic
1081964173 11:47159550-47159572 AAGAGTAAGGGGGAGGCGGGTGG + Intronic
1082167435 11:48965053-48965075 CTGAGCAAAGAGGAGGAGGTGGG + Intergenic
1083882025 11:65553532-65553554 TAGGGGAAGGAGGGGGAGGTGGG + Intronic
1083935952 11:65870245-65870267 TAGAGGCAGGAGAAGGAGGGCGG + Intronic
1084137597 11:67198080-67198102 TAGGCTAAGGAGGAAGAGGTGGG + Intronic
1084347667 11:68566300-68566322 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
1084365359 11:68694010-68694032 TAGAGCAAGTAGGAGGTGGACGG - Intergenic
1085023845 11:73225250-73225272 CAAAGTCAGGAGGAGGAGCTGGG - Intronic
1085279619 11:75321286-75321308 TAGAGTCCTGAGGAAGAGGTGGG - Intronic
1085362491 11:75903093-75903115 AAGAGAGAGGAGGAGGAGGAAGG - Intronic
1086026122 11:82293856-82293878 GAGACTCAGGAGGATGAGGTGGG + Intergenic
1086216365 11:84387070-84387092 AAGAGCAAGGAAGAGGTGGTGGG - Intronic
1086274124 11:85104905-85104927 GAGAGAAAGGAGAAAGAGGTGGG + Intronic
1086341814 11:85855069-85855091 GGGAGTAGGGAGGAGGACGTCGG + Intergenic
1086578586 11:88369839-88369861 TAGACTCAGGAGAAAGAGGTTGG - Intergenic
1086720857 11:90119400-90119422 TAGAGGAAGAAGGAGGATGTTGG + Intergenic
1087284777 11:96253374-96253396 TTGAGTAAGGAAGGGGAGCTTGG - Intronic
1087672848 11:101127893-101127915 AAGATAAAGGAGGAGGAGGAAGG - Exonic
1087761640 11:102109947-102109969 TAACGCGAGGAGGAGGAGGTGGG + Intergenic
1088553954 11:111042824-111042846 TAGAAAAAGGAGGAAGAGGCTGG + Intergenic
1088762995 11:112949857-112949879 GAGGGTAAGGAGCAAGAGGTGGG + Intergenic
1089378597 11:118012100-118012122 TAGAGCAAGTGGGAGGAGGAGGG - Intergenic
1089845825 11:121457240-121457262 AAGAGTAAGGAGGCGGAATTTGG + Intronic
1089905227 11:122031424-122031446 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1090613964 11:128497767-128497789 TGGAGGATGGTGGAGGAGGTAGG - Intronic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1202815516 11_KI270721v1_random:44955-44977 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091744499 12:2982513-2982535 TTGGGGAAGGAGGAGGAGGCTGG + Intronic
1091774223 12:3173843-3173865 TAATTTAAGGAGGAGGAGGGAGG - Intronic
1091926168 12:4351815-4351837 AAGATTAAGGAGGTGGTGGTGGG - Intronic
1091975074 12:4817769-4817791 TAGAGTAACAATGATGAGGTTGG - Intronic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093502600 12:19829103-19829125 TAGAGAAAGGAAGATGAGTTTGG + Intergenic
1093565311 12:20595949-20595971 GAAAATAAGGAGGAGGATGTAGG - Intronic
1093613948 12:21197695-21197717 TGGATTAAGGAGAAGGAAGTCGG + Intronic
1093785967 12:23192660-23192682 TAGGGGAAGGAGGAAGAGGCAGG - Intergenic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094676698 12:32627516-32627538 AAGGGGAAGGAGGAGGAGATGGG + Intronic
1095540125 12:43299919-43299941 AAGGGGAAGGAGGAGGAGGTGGG + Intergenic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096228265 12:49882971-49882993 TAGGGTAGGGAGGAAGAGGGAGG + Intronic
1096580696 12:52582933-52582955 TACAGGAAGGAGGAGGGGGCAGG - Intergenic
1096693549 12:53335295-53335317 TGGAGAAAGGAGGGGGAGGGGGG - Intronic
1096747297 12:53737415-53737437 TTGAGGAATGAGGAGGAGCTGGG + Intergenic
1096748051 12:53741346-53741368 TAGAGTTAGGAAGTGCAGGTTGG - Intergenic
1097162717 12:57060179-57060201 CAGAGTAAGGACAAGGATGTTGG - Intronic
1097285203 12:57871934-57871956 GAGAATATGAAGGAGGAGGTAGG - Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098534418 12:71578364-71578386 GAGAGGAAGGAGCAAGAGGTGGG - Intronic
1099048464 12:77753650-77753672 TAGAAAAAGGAGGGGGAAGTAGG + Intergenic
1099064935 12:77963997-77964019 AAGAGGAGGGAGGAGGAGGGAGG - Intronic
1099156421 12:79181913-79181935 AAGAGCATGGAGGATGAGGTAGG - Intronic
1099931589 12:89081807-89081829 TATTGTATGGAGTAGGAGGTGGG + Intergenic
1100791615 12:98136388-98136410 TGGAGTAAGGAGGAGAAGCTTGG - Intergenic
1101122015 12:101591978-101592000 TAGAGCAAGAAGGAGGAGTCTGG + Intronic
1101771286 12:107753960-107753982 GAGGGTAAGGTGGTGGAGGTAGG + Exonic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102753895 12:115321121-115321143 GAAAGGAAGGAGGGGGAGGTTGG - Intergenic
1102792345 12:115657933-115657955 GATAGTAATGAGGAGGAGGGGGG - Intergenic
1102799154 12:115716469-115716491 TAAAGGAAGCAGGAGGAGGCTGG + Intergenic
1102859452 12:116322630-116322652 GAGAGTGGGGTGGAGGAGGTTGG - Intergenic
1103367015 12:120390772-120390794 GAAAGGAAGGAGGAGGAGGAAGG + Intergenic
1103397939 12:120622318-120622340 GGGAGTAAGGAGCAGGATGTCGG + Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104456613 12:128919159-128919181 TAGAGTAAGGTTGATGAGGACGG - Intronic
1104458811 12:128937392-128937414 TGGAGATAGGAGGAGAAGGTGGG + Intronic
1104649708 12:130522706-130522728 CAGGGAGAGGAGGAGGAGGTGGG + Intronic
1104782783 12:131432554-131432576 GAGAATGAGGAGGAGGAGTTGGG + Intergenic
1104798300 12:131535241-131535263 TAAAGACACGAGGAGGAGGTAGG + Intergenic
1105002358 12:132698904-132698926 TAAAGTAAGGGGGAGAAGCTGGG - Intronic
1105262748 13:18791902-18791924 TAGGGTGGGGAGGAGTAGGTTGG - Intergenic
1105572846 13:21620348-21620370 AAGAGAAAGGAGAAGGAGATTGG - Intergenic
1105738332 13:23295708-23295730 GAGAGGAAGAAGGAGGAGGAAGG - Intronic
1106471244 13:30056577-30056599 AAGAGGAAGGAGGAAGAGATAGG - Intergenic
1106784897 13:33096901-33096923 TAGACTGAGGAGGAGGAGGAGGG + Intergenic
1107526110 13:41233283-41233305 TAGAGGAAGTAGGAAGAGGGTGG + Intronic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108605112 13:52029825-52029847 GAGAGTGAGGAAGAGGAGGGAGG + Exonic
1109621701 13:64916804-64916826 AAGAGTGAGGAGGAGGAAGGAGG - Intergenic
1109641581 13:65198770-65198792 TAAAATAAGCAGGAAGAGGTAGG - Intergenic
1110028710 13:70576676-70576698 TAGGGGGAGCAGGAGGAGGTGGG - Intergenic
1110244241 13:73303658-73303680 AAGAAGAAGGAGGAGGAGCTAGG - Intergenic
1113069162 13:106402838-106402860 GAGAATGAGGAGGAGGAGATAGG - Intergenic
1113088419 13:106592236-106592258 TAGGCCAAGGAGGAGGAGGAGGG - Intergenic
1113222702 13:108123251-108123273 TGGAGGAAGGAGGAGATGGTAGG + Intergenic
1113285275 13:108839723-108839745 TGTAGTGAGGAGGAGGAAGTAGG - Intronic
1113759982 13:112840396-112840418 GAGAGTAAGGAGGCTGAGGCAGG - Intronic
1114236042 14:20824613-20824635 TAGAGGAAGGTGCAGGTGGTGGG + Intergenic
1114754138 14:25239910-25239932 TAGAGAAAGGATGAAGAGGTAGG + Intergenic
1115131140 14:30053384-30053406 TAGATTATGGAGGAGGTGGTGGG - Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117367889 14:55049697-55049719 TAGAGAAGGGAGCAGAAGGTGGG + Intergenic
1117553334 14:56858110-56858132 GAGAGAAAGAAGGAGGAGGAGGG + Intergenic
1118306619 14:64660420-64660442 GAGAGTAAGGAGGTGGATGCAGG - Intergenic
1118589409 14:67390349-67390371 GTGAGTAGGGAGGATGAGGTAGG - Intronic
1119770195 14:77215820-77215842 TAGAAGAAGTAGGAGGAGGGGGG - Intronic
1120218164 14:81703150-81703172 TAAAGTCAGGAGGAGGAGGGGGG + Intergenic
1120899906 14:89566864-89566886 GAGGGTAAGGAAGAGGAGGGGGG - Intronic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121157342 14:91698856-91698878 GAGACTCAGAAGGAGGAGGTTGG - Intronic
1121170996 14:91854460-91854482 GAGGGGAAGGAGGAGGAGATAGG + Intronic
1121472715 14:94167678-94167700 AAGAGAAAGAGGGAGGAGGTGGG - Intronic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1123131413 14:105988580-105988602 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123581646 15:21719777-21719799 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123618295 15:22162400-22162422 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123775136 15:23571937-23571959 TAAAGTAAGCAGGAGGAATTAGG + Intronic
1124367298 15:29081236-29081258 TACACCAAAGAGGAGGAGGTGGG - Intronic
1124406985 15:29401985-29402007 TAGATTAAGGAGGAGGCGAGGGG + Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125402385 15:39318010-39318032 AAAGGTAAGGAGGAGGAGGAGGG - Intergenic
1125431532 15:39599527-39599549 GAGAGAAAGAAGGAGGAGGGAGG - Intergenic
1125458461 15:39885409-39885431 TAGAGCAAGGAGGTGGGGGATGG - Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125929427 15:43589897-43589919 GAGAGTACCGAGGAGGGGGTCGG - Intronic
1125942594 15:43689729-43689751 GAGAGTACCGAGGAGGGGGTCGG - Intergenic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126824584 15:52536497-52536519 GAGAATATGCAGGAGGAGGTGGG - Intergenic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127280912 15:57491856-57491878 TGCAGGAAGGAGGAGGAGGAGGG - Intronic
1127453701 15:59139624-59139646 TAGAGTAATAAGGAAGGGGTAGG - Intronic
1127714193 15:61632414-61632436 TATAGTAAGGAGGAGGCAGAGGG - Intergenic
1127782029 15:62325439-62325461 GAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1128095821 15:64954599-64954621 AAGAGGAAGGAGGAGGAAGAAGG - Intronic
1129031602 15:72622513-72622535 TAGAGTACCAGGGAGGAGGTGGG - Intergenic
1129218327 15:74114946-74114968 TAGAGTACCAGGGAGGAGGTGGG + Intronic
1129406017 15:75318631-75318653 TAGAGTACCAGGGAGGAGGTGGG - Intergenic
1129727925 15:77911043-77911065 CAGAGGAAGGAGGAGGGGATGGG - Intergenic
1129765037 15:78159291-78159313 AAGAAAAAGGAGGAGGGGGTAGG - Intronic
1129839954 15:78737817-78737839 CAGAGGAAGGAGGAGGGGATGGG + Intergenic
1130226000 15:82058839-82058861 TAGAGAAAGGAAGAGGAGGGAGG - Intergenic
1131014151 15:89043506-89043528 AAGAGGAAGGAGGAAGAGGAGGG + Intergenic
1131108860 15:89751678-89751700 TAGAGTAAGGACCAGGAGCAGGG + Intergenic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131150858 15:90046473-90046495 TAGAGGAGGGTGGAGGAGGGCGG + Intronic
1131852120 15:96554629-96554651 AAAAGGAAGGAGGAGGAGGGAGG - Intergenic
1131901094 15:97088626-97088648 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1132078636 15:98845502-98845524 AGGAGGAAGGAGGAGGAGGGAGG - Intronic
1132145087 15:99424927-99424949 TAGATTCAGGAGGAAGAGGTGGG - Intergenic
1132857800 16:2054776-2054798 TGGAGAAAGGAGGAGGAAGACGG - Intronic
1132906749 16:2286425-2286447 TAGATTTAGGAGGAGAAGGCAGG + Intronic
1133520126 16:6549124-6549146 GGGAGGAAGGAGGAGGAGGAGGG + Intronic
1133520183 16:6549264-6549286 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133520278 16:6549518-6549540 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133759279 16:8785475-8785497 CAGTGTAAGGAGCAGGACGTGGG + Intronic
1133850167 16:9495982-9496004 AAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1134449395 16:14354215-14354237 TAGAGGGAGGAGGAGGAAGGGGG + Intergenic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1135066565 16:19314982-19315004 GAGAGGAAGGAGGAGGGGGTGGG + Intronic
1135112564 16:19702061-19702083 TAGACTCGGGAGGCGGAGGTTGG - Exonic
1136045219 16:27610013-27610035 TGGAGTGAGGAGGAGGAGTGGGG + Intronic
1136080987 16:27852530-27852552 CAGAGGGAGGAGGAGGAGGGTGG + Intronic
1136138883 16:28276162-28276184 TTGAGGAGAGAGGAGGAGGTGGG + Intergenic
1136539100 16:30918720-30918742 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1137251052 16:46741174-46741196 TAGAGTCAGTAGGAGGATTTGGG + Intronic
1137413104 16:48245888-48245910 TAGAGTTAGGAATAGGAGGCGGG - Intronic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137667715 16:50261442-50261464 GAGAGGCAGGAGGAGGAGGCAGG + Intronic
1137834027 16:51573238-51573260 CAGAGTAGGGAGCAGAAGGTGGG + Intergenic
1138053684 16:53810480-53810502 AAAAGGAAGGAGGAGGAGCTAGG - Intronic
1138126161 16:54440458-54440480 AGGAGGAAGGAGGAGGAGGGCGG - Intergenic
1139424972 16:66873817-66873839 GAGAGGAAGGGGGAGGAGGAGGG - Intergenic
1139424994 16:66873870-66873892 AGGAGGAAGGAGGAGGAGGGAGG - Intergenic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139946325 16:70644890-70644912 AAGAGGAAGGAGGAAGAGGAGGG + Intronic
1139980618 16:70855376-70855398 TAGACAAAGGCGGAAGAGGTTGG - Intronic
1140357047 16:74315377-74315399 TAGAATAGGGAGGAGGGGGAAGG - Intergenic
1141150497 16:81561534-81561556 TAGAGTGAGGGGGAAGAGGGTGG + Intronic
1141393322 16:83682644-83682666 CAGAGGAAGGAGGAGGAGTGAGG - Intronic
1141673728 16:85506567-85506589 TTGAGGATGGAAGAGGAGGTTGG + Intergenic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1141845219 16:86603888-86603910 GAAAGGAAGGAGGAGGAGGGAGG - Intergenic
1142958174 17:3535235-3535257 AGGAGTAAGGAGGGGGAGGGAGG - Intronic
1143091260 17:4450243-4450265 AGGAGGAAGGAGGAGGAGGAGGG - Intronic
1143779588 17:9222229-9222251 TGGAGTGAGGAGGAGGACGGAGG - Intronic
1143794699 17:9327250-9327272 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1145104326 17:20102779-20102801 TAAGGCAAGGAGGAGGAGGGAGG - Intronic
1145372809 17:22321510-22321532 TAGAGTTAGGATGCAGAGGTCGG - Intergenic
1145897643 17:28469744-28469766 TAGGGTAAGGAGGAGGAGTCAGG + Intronic
1146021635 17:29284237-29284259 TAGAGAAAGGAGGAAGAGGTAGG + Intronic
1146023589 17:29299946-29299968 TAAAATATGGAGGATGAGGTAGG + Intergenic
1146370768 17:32264646-32264668 TAGAGTAGGGATGGGGAGGAGGG + Intergenic
1147349352 17:39827953-39827975 TGGATTAGGGAAGAGGAGGTGGG + Intronic
1147391616 17:40112730-40112752 TGGAGGAAGGAGGAGTAGGGCGG - Intergenic
1147742014 17:42675232-42675254 TAGAGCCAAGAGGGGGAGGTGGG + Intronic
1147813313 17:43189564-43189586 TAGAATATGGAGCAGAAGGTAGG - Intronic
1147814908 17:43202215-43202237 TAGAGTATGCAGGAGGAGCATGG - Intronic
1147945437 17:44077806-44077828 AAGAGGAAGGAGGAGGAGAGGGG + Exonic
1148205106 17:45775137-45775159 TGGAGCAAGGAGGGTGAGGTTGG - Intergenic
1148464746 17:47858092-47858114 TAGGGGCGGGAGGAGGAGGTGGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149170276 17:53801384-53801406 GAGAGAAAGGGGGAGGAGGAAGG + Intergenic
1149481011 17:57003137-57003159 TTAAGGAAAGAGGAGGAGGTGGG + Intronic
1149712560 17:58756277-58756299 GAGGGTGAGGAGGAGGAGGAGGG + Exonic
1149978692 17:61291917-61291939 TAGGGTGAGGAGGAAGAGGGTGG + Intronic
1150137001 17:62701608-62701630 TTCAGTAAAGAGGAGGAGGGAGG + Exonic
1150150646 17:62806561-62806583 GAGAGAAAGGAGGAGGGAGTTGG + Intronic
1150601223 17:66652827-66652849 TAGAGTAAGAGGGTGGAGGCAGG - Intronic
1150674645 17:67234522-67234544 TAGAGTAAGGATGAGTATGATGG - Intronic
1151497460 17:74467205-74467227 CAGGGTACGGAGGAGGGGGTGGG + Intronic
1151624373 17:75267533-75267555 TTGAGCAAGGAGGAGGAGGTGGG - Exonic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152324019 17:79625144-79625166 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1152913131 17:83016781-83016803 GGGAGGAAGGAGGAGGAGGAGGG + Intronic
1153366552 18:4263614-4263636 TAAAGTGAGGAGGAGGACATAGG - Intronic
1153503333 18:5770602-5770624 TAGGGTAAAGAGGATGAGGGGGG + Intergenic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1154425082 18:14265849-14265871 TAGGGTGAGGAGGAGTAGGCTGG + Intergenic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1155344611 18:24846214-24846236 GAGAGGAAGGAGGAAAAGGTGGG - Intergenic
1155517383 18:26637211-26637233 TAGAGTCAGGAGGAGGAAGGAGG - Intronic
1155697326 18:28698377-28698399 TGGAGTAAAGAGCAGGAGGACGG + Intergenic
1155930034 18:31697389-31697411 TAGAGGAAGGGGGAAGAGGGAGG + Intergenic
1156346295 18:36259996-36260018 AAGAGTAAGTAGGGGGAGGATGG - Intronic
1157865876 18:51184197-51184219 TTGAGTAGGGAGTGGGAGGTGGG - Intronic
1158182346 18:54730660-54730682 GAGAGTGAGGAGGAGGAGTCAGG - Intronic
1158737391 18:60098789-60098811 AAGAGGAAGGAGGAGGAAGAAGG - Intergenic
1159053395 18:63442559-63442581 TAAAGGAAGAAGGAGGAGGAGGG + Intergenic
1160021799 18:75187035-75187057 AGGAGTCAGGAGGAGGAGGCAGG - Intergenic
1160448626 18:78946975-78946997 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1160480305 18:79233988-79234010 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
1160693135 19:469327-469349 CAGAGTTAGGAGGCTGAGGTGGG - Intronic
1160906679 19:1454983-1455005 TAGGGTAAGGGGGGGGGGGTGGG - Intronic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161441530 19:4294538-4294560 GAGGGTAGGGCGGAGGAGGTGGG - Intronic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161756428 19:6137456-6137478 CAGAGTGAGGAGGGGGAGGGAGG + Intronic
1161800575 19:6415101-6415123 AGGAGAAAGGAGGAGGAGGAGGG + Intronic
1161803484 19:6429292-6429314 TATAGAAAGGAGGAGGAGATTGG + Intronic
1161957949 19:7506691-7506713 CAGAGAAAGGGGGAGGAGCTTGG - Intronic
1161957998 19:7506856-7506878 CAGAGGAAGGGGGAGGAGCTGGG - Intronic
1162339212 19:10081755-10081777 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1162502076 19:11059837-11059859 GAGAGTGAGGAGGAGGAAGAGGG + Exonic
1162678226 19:12317108-12317130 TAGAGTATACAGGAGGATGTGGG + Intergenic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163478942 19:17543179-17543201 TGGGACAAGGAGGAGGAGGTTGG + Intronic
1163552421 19:17973052-17973074 GAGAGTAAGAAGGACGAGATAGG + Intronic
1164473404 19:28554559-28554581 TGGTCTCAGGAGGAGGAGGTAGG - Intergenic
1164591913 19:29512082-29512104 GAGAGCAAGGATGAGGAGGAAGG + Intergenic
1164591989 19:29512351-29512373 GAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164592167 19:29513051-29513073 TAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164592691 19:29514807-29514829 GAGAGTGAGGATGAGGAGGAAGG + Intergenic
1164790248 19:30971453-30971475 GAGAGTCTGGAGAAGGAGGTGGG - Intergenic
1165416039 19:35694111-35694133 AAGAGGGAGGAGGAGGAGGAAGG - Intergenic
1165426737 19:35750090-35750112 TAGAGTAGGGAGGAGGTGGGTGG + Intronic
1165694034 19:37886730-37886752 GAAAGGAAGGAGGAGGAGGAAGG - Exonic
1166329506 19:42069975-42069997 AAGAGAAAGGCGGAGGAGGGTGG + Intronic
1166882073 19:45935758-45935780 CAAAGTAAGAAGGAGGATGTGGG + Exonic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167528711 19:50001542-50001564 GGGGGTAAGGAGCAGGAGGTGGG - Intronic
1167608171 19:50492805-50492827 AAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1167904633 19:52648927-52648949 TAGAGGGTGGAGGTGGAGGTAGG - Intronic
1168024211 19:53631985-53632007 CAGAGAAAGGTGGAGGAGGTGGG + Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925716034 2:6785337-6785359 TAGAGCAAAAAGGAAGAGGTAGG - Intergenic
925738689 2:6986288-6986310 CAGAGTAGGGAGGAGGAAATCGG - Intronic
925948374 2:8887908-8887930 TAGAGTAAGGAAATGGAGGGAGG - Intronic
926105444 2:10146721-10146743 AAGGGTAGGGAGGAGGAGGAGGG + Intronic
926141649 2:10371659-10371681 TAGAGGGAGGAGGAGGAGTTTGG - Intronic
926266839 2:11330876-11330898 AAGAGGAATGAGGAGGAGGGAGG + Intronic
926580016 2:14624811-14624833 TTAAGTAAGGAGGAGGAGGTAGG + Intergenic
927924431 2:27000623-27000645 GAGAGACAGGAGGAGGAGGAGGG + Intronic
928247742 2:29645827-29645849 TAAAGAAAGGATGATGAGGTAGG - Intronic
928294334 2:30069733-30069755 TAGAGGAAGGAGGAGGAAAGGGG + Intergenic
929056844 2:37885688-37885710 GAGGGTAGGGAGGAGGAGGTTGG - Intergenic
929408407 2:41669177-41669199 TAGGGAAAGGAGGAGGAAGGAGG - Intergenic
929507562 2:42540110-42540132 TTGAGTCAGGTGAAGGAGGTGGG + Intronic
929910953 2:46089182-46089204 TAGAATAAGAATGAGGAGGGAGG - Intronic
930066556 2:47332303-47332325 GAGGGTGAGGAGTAGGAGGTGGG + Intergenic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
931218246 2:60265713-60265735 TACAGGAAGGAGCAGGAAGTGGG + Intergenic
931541503 2:63334589-63334611 TAGAGTGAGTAGTAGGAGGCTGG + Intronic
932208156 2:69902268-69902290 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
932271365 2:70413069-70413091 AGGAGGATGGAGGAGGAGGTGGG + Intergenic
932301091 2:70667388-70667410 TAGAGGCTGGAGGAGGAGGGGGG + Intronic
932555380 2:72819489-72819511 CAGAGAAAGGAGGAGGAGATAGG - Intronic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
934037450 2:88100022-88100044 TAGGAGAAGGAGCAGGAGGTGGG - Intronic
934716444 2:96547362-96547384 AGGAGTAAGGAGGAAGGGGTGGG - Intronic
934928607 2:98400645-98400667 TACAGTAAGGAGGTTGAGGTGGG + Intergenic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935531675 2:104240391-104240413 AAGAGGGAGGAGGAGGAGGGAGG + Intergenic
936995042 2:118404558-118404580 GACATTAACGAGGAGGAGGTGGG + Intergenic
937392317 2:121500260-121500282 AACACGAAGGAGGAGGAGGTGGG + Intronic
937454143 2:122026755-122026777 TAGAGCAAGAAGGTGGAGGAAGG - Intergenic
937704149 2:124898856-124898878 TACTGTTAGGAGGAGGAGGCCGG - Intronic
938310516 2:130285883-130285905 TAGAGAAGGGAGCAGGTGGTCGG - Intergenic
938391597 2:130911125-130911147 TGAGGTCAGGAGGAGGAGGTGGG + Intronic
938429926 2:131225023-131225045 AAGAGTAAGGAGTAGGAGAGAGG - Intronic
938444411 2:131366484-131366506 TAGAGAAGGGAGCAGGTGGTCGG + Intergenic
938594703 2:132776329-132776351 TAGAGAAAGGAGGTGGAGAAGGG - Intronic
938935254 2:136121903-136121925 TAGAGAAAGGAGGAGGTGCCAGG + Intergenic
938999388 2:136716387-136716409 TAGAGTGAGGAGGATGAGGAGGG + Intergenic
939360578 2:141166666-141166688 TAGAGTGGGGAGGGGGAAGTGGG - Intronic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940752413 2:157641177-157641199 TTAAGGGAGGAGGAGGAGGTAGG + Intergenic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941675199 2:168336885-168336907 TGGAGTGAGGAGGAGGAGGGAGG - Intergenic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942264095 2:174203664-174203686 TAGAGTAAAATGGAGGAGCTGGG - Intronic
942299380 2:174547335-174547357 AAGAGGGAGGAGGAGGAGGAGGG - Intergenic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942542959 2:177033723-177033745 TAGAGGAGGAAGGAGGAAGTTGG - Intergenic
943253620 2:185565059-185565081 TAAAATAAGGAGGCTGAGGTGGG + Intergenic
944827586 2:203501027-203501049 TAGAGAAAGGGGCAGGAGGGAGG + Intronic
944915603 2:204357491-204357513 TTTCGTGAGGAGGAGGAGGTGGG + Intergenic
945143584 2:206713592-206713614 TAGAGTTAGGAGGACATGGTGGG + Intronic
946405647 2:219490666-219490688 GGGAGTAGGGAGGAAGAGGTAGG + Intronic
946433731 2:219638874-219638896 GAGAGATGGGAGGAGGAGGTGGG + Intronic
947351675 2:229252870-229252892 TAGAGAAAAGACAAGGAGGTGGG + Intronic
947531947 2:230914890-230914912 GAGAGAGAGCAGGAGGAGGTGGG + Intronic
947619507 2:231580593-231580615 AAGAGGGAGGAGGAGGAGGAGGG + Intergenic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1168865816 20:1085618-1085640 TCCAGGCAGGAGGAGGAGGTAGG + Intergenic
1170202082 20:13755173-13755195 TGGAGTAAGGAAGAGAAGTTGGG + Intronic
1170510173 20:17068270-17068292 TAAAATATGGAGGAGGAGGCAGG + Intergenic
1170950683 20:20933309-20933331 GAGATTAAGAAGCAGGAGGTTGG - Intergenic
1171040319 20:21756829-21756851 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1171161388 20:22927288-22927310 TAGGCTGAGGAGGAGGAGGAAGG - Intergenic
1171193314 20:23177738-23177760 TATAGTAAGGAAGAGGAGAGGGG - Intergenic
1171486390 20:25489460-25489482 GGGAGTAAGGAGAAGGAGGGGGG - Intronic
1171947231 20:31389487-31389509 CAAAGTAAGGAGTAGGAAGTTGG - Intronic
1171983914 20:31646086-31646108 GAGAGGAAGCAGGAGTAGGTTGG + Intergenic
1172038693 20:32028776-32028798 TAGAGGAAGAAGGAGAAGGGGGG + Intronic
1172455478 20:35068916-35068938 TAAACTAAGGTGGAGGTGGTGGG + Intronic
1172874205 20:38154488-38154510 TTGAGCAAGGGGGAGGAGGCAGG - Intronic
1173045314 20:39504108-39504130 TAGTGTGAGTAGGAGGAGGGAGG + Intergenic
1173525424 20:43729039-43729061 TAGAAGAAGGAAGAGGATGTGGG + Intergenic
1174576468 20:51541443-51541465 TAGAGGGAGGAGGAGGAGGAGGG - Intronic
1174618236 20:51853102-51853124 TAGCCTGAGGAGGTGGAGGTGGG + Intergenic
1174868846 20:54164734-54164756 TATTGAAAGGAGGTGGAGGTGGG - Intronic
1174961950 20:55167578-55167600 CAGAGAGAGGAGGAGGAGATAGG + Intergenic
1175070901 20:56332945-56332967 GAGAGAAAGGAGGAGGAGCCAGG - Intergenic
1175100631 20:56576269-56576291 TAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1175190811 20:57211169-57211191 TGGAGGAGGGAGGAGGAGGTGGG - Intronic
1175298882 20:57928758-57928780 AAGAGAAAGGAGGAGGAAGATGG - Intergenic
1175334341 20:58185374-58185396 GAAGGTAGGGAGGAGGAGGTGGG - Intergenic
1175657805 20:60787023-60787045 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
1175723385 20:61300855-61300877 AAGGGTGAGGAGGAGGAGGTGGG - Intronic
1175723877 20:61303703-61303725 GGGAGCAGGGAGGAGGAGGTAGG + Intronic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175802622 20:61809831-61809853 TAGAGTGAGGACGGTGAGGTCGG + Intronic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1178038232 21:28609026-28609048 TAGAGGAAGGAACAGGTGGTGGG - Intergenic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179085650 21:38215241-38215263 TGGGGTAGGGAGGAGGAGGGTGG + Intronic
1179346626 21:40564470-40564492 TAGAGGAAGGAGGAGGGTGGTGG - Intronic
1181053614 22:20249067-20249089 TGGAGCATGGAGGAGCAGGTGGG - Intronic
1181546516 22:23605515-23605537 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1181580584 22:23825862-23825884 TAGAGTAAGAAGGAGCTGCTAGG - Intronic
1182057300 22:27369661-27369683 CAGAGTGAGGGGGAGGAGGAGGG + Intergenic
1182085807 22:27560401-27560423 TAGAGTCTGGAGCAGGAGGCAGG - Intergenic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182806159 22:33072282-33072304 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
1182835537 22:33338461-33338483 AAGAAATAGGAGGAGGAGGTAGG - Intronic
1183209234 22:36440369-36440391 TAGAGTAAAAAAGATGAGGTTGG + Intergenic
1183391156 22:37546291-37546313 TAGAGAAGGGAGGAGGAGCGAGG - Intergenic
1183547227 22:38460921-38460943 GAGGGTAAGGAGGAGGTGGCAGG + Intergenic
1183556229 22:38529447-38529469 TATGGCAAGGAGGAGGAGATGGG + Intronic
1183909613 22:41068612-41068634 TGGATTAAGGAGGTGGTGGTGGG - Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185023094 22:48391966-48391988 TAGAGTCAGGAGGAGAAGAGGGG + Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949920033 3:8993279-8993301 AAGAGAAAAAAGGAGGAGGTAGG - Intronic
950167627 3:10813820-10813842 TATTGTGAGGAGGAGGAGGATGG - Intergenic
950167643 3:10813909-10813931 TATTGTGAGGAGGAGGAGGATGG - Intergenic
951494373 3:23309906-23309928 TAGAGGAAGGTGGAGGAAGATGG + Intronic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
952367386 3:32686714-32686736 TAAAATAAGGAGGAAGATGTTGG - Intronic
952464302 3:33565059-33565081 TAGGCTAAGGAGGAAGAGGAGGG - Intronic
952751150 3:36825973-36825995 TAGAGTAGGGGCGTGGAGGTTGG - Intergenic
952883686 3:38000409-38000431 GAGGGAAGGGAGGAGGAGGTGGG + Intronic
953221094 3:40972278-40972300 TAGAGTAGGGAGAAGGATGCAGG - Intergenic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
954604792 3:51900937-51900959 TAGAGGAAGGTGCAGGCGGTGGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955347659 3:58173108-58173130 GAGACAGAGGAGGAGGAGGTGGG - Intergenic
955510923 3:59679524-59679546 ATGAGTAAGAAGGAGGAGGGTGG + Intergenic
955562375 3:60205612-60205634 TAGAGCATGGTGGATGAGGTGGG + Intronic
955850996 3:63219785-63219807 TAGACTGAGGAGGAGGAGGAAGG + Intergenic
955960987 3:64341383-64341405 TAGAGAAAGGTGGGGGTGGTTGG - Intronic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
957959167 3:87227393-87227415 GAGAGACAGCAGGAGGAGGTCGG - Exonic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959034658 3:101346940-101346962 TAAAAAAAGGAGGAGGAGGGAGG + Intronic
959963810 3:112332213-112332235 AAGACGAAGGAGGAGGAGGAGGG + Intergenic
961011674 3:123440553-123440575 TAAAGAAAGGAAGAGGAGATTGG - Intronic
961266577 3:125647807-125647829 TGGCGTCAGGAGGAGGGGGTGGG + Intergenic
961516286 3:127439416-127439438 TTAAGCAAGGAGGAGGAGGAGGG + Intergenic
962080562 3:132135065-132135087 TAGAGGAAGGAAGAGGCTGTGGG - Intronic
962200157 3:133394410-133394432 GAGAAGGAGGAGGAGGAGGTGGG - Intronic
962826992 3:139107579-139107601 CAGAGCAAGGTGGAGGAGGTGGG + Intronic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
963341972 3:144047137-144047159 TTGAGTAAAAAGGAGGAGGGAGG - Intronic
963347855 3:144117258-144117280 TAAAGTAAGAATGAGGGGGTGGG - Intergenic
963393861 3:144706204-144706226 CAGAGTAAGGAAGAGATGGTTGG + Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964441716 3:156718169-156718191 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
964537935 3:157746096-157746118 TAGGGTGAGAAGGAGGAGGAAGG + Intergenic
966351678 3:179038127-179038149 TAGAGAAAGGGGGAAGAGCTGGG + Intronic
966636341 3:182138165-182138187 TAGAGGAAGGAAAAGGAGGGAGG + Intergenic
966951228 3:184819992-184820014 TAGGCTGAGGAGGAGGAGGAGGG + Intronic
966981357 3:185139138-185139160 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
967728073 3:192880456-192880478 TAAAGGAAGGAGGAGGAAGCAGG + Intronic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968350541 3:198048621-198048643 TAGGGTAGGGAGGAGTATGTTGG - Intergenic
968814650 4:2815576-2815598 TGGAGCCAGGAGGAGGTGGTGGG + Intronic
969040096 4:4289409-4289431 GAGAGGGAGGAGGATGAGGTGGG - Intronic
970166394 4:13242745-13242767 CAGGGTTAGGAGGAGGATGTAGG - Intergenic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970368939 4:15388925-15388947 AAGAGCAAGGAGGAGCAGGGAGG + Intronic
970802572 4:19991488-19991510 GAGACTAAGGAGGATGAGGAGGG - Intergenic
973604010 4:52569165-52569187 TAGAGCAAGGAGGAGCATGTGGG + Intergenic
975583872 4:75930980-75931002 TAGAGAGTGAAGGAGGAGGTGGG - Intronic
975912686 4:79286347-79286369 TTGAGCAATGAGGATGAGGTGGG + Intronic
977349066 4:95857423-95857445 TACAGCAAGGAGTAGGAGTTCGG + Intergenic
977611231 4:99034184-99034206 GAGAGGAAGGAGGAGAAGGAGGG - Intronic
978073068 4:104494762-104494784 GGGTGGAAGGAGGAGGAGGTGGG + Exonic
978314224 4:107418001-107418023 TAGAGGAAGGTGCAGGTGGTGGG - Intergenic
978632890 4:110767448-110767470 TGGTGTAGGGAGGAGGAGGCTGG + Intergenic
979541856 4:121892821-121892843 TAGAGAAATAAGGAAGAGGTTGG + Intronic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
983589337 4:169390392-169390414 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
983647895 4:170010512-170010534 TAGACTGAGGAGGAGGGGGAGGG - Intronic
984251375 4:177339555-177339577 TAGATTGAGGAGGAAGAGGAGGG + Intronic
984700316 4:182814793-182814815 TGGAGTAAAGAGCAGGAGGACGG - Intergenic
985263306 4:188135321-188135343 TAGGCTGAGGAGGAGGAGGTGGG - Intergenic
986867964 5:12012468-12012490 TAAAGTAATGAGGAGGTGGTGGG + Intergenic
986963185 5:13239976-13239998 TGGAGAAAGGAGGATGAGCTTGG + Intergenic
988153133 5:27413633-27413655 TAGAGTGAAGAGGAGGAGCAAGG - Intergenic
988359537 5:30217883-30217905 TAAAGTGAGGAGGAGAGGGTGGG - Intergenic
988650521 5:33144312-33144334 AACAGTATAGAGGAGGAGGTAGG + Intergenic
988947314 5:36218704-36218726 TGGAGGAAGGAGCATGAGGTTGG - Intronic
989816056 5:45738789-45738811 TACTGTAAGGAGGCTGAGGTGGG - Intergenic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
992011583 5:72532744-72532766 GAGAGTAAGTAAGAGCAGGTAGG + Intergenic
992737867 5:79742021-79742043 AAGAGGGAGGAGGAGGAGGAAGG - Intronic
992959407 5:81943590-81943612 TAGAATAAGGAGAAGAACGTTGG + Intergenic
993077647 5:83254381-83254403 AAGGGTAATGAGGAGGAGGGTGG - Intronic
993989942 5:94643793-94643815 CCAAGTAAGGAGGAGGATGTAGG - Intronic
994099859 5:95880651-95880673 AAGAGAAGGGAGGAGCAGGTGGG + Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
994869686 5:105331632-105331654 GAGAGGGAGGAGGAGGAGGGAGG + Intergenic
995349269 5:111156327-111156349 TAGAGGCAGAAGGAGGAGGTAGG - Intergenic
996822638 5:127647758-127647780 TATAGGAAGGAGGGTGAGGTCGG + Intergenic
997367160 5:133333382-133333404 GAGAGAAAGGAGGTGGAGATGGG - Intronic
997626302 5:135333292-135333314 GAGAGAACGGTGGAGGAGGTGGG - Intronic
997771767 5:136561639-136561661 AAGAGGAAGGAGGAGAAGGAGGG - Intergenic
998136225 5:139676102-139676124 GGGAGTACCGAGGAGGAGGTGGG - Intronic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998524672 5:142831647-142831669 GAGAGGGAGGAGGAGGAGGAGGG - Intronic
998617925 5:143761317-143761339 TAGATTAAGGACATGGAGGTGGG + Intergenic
998991582 5:147823220-147823242 AAGAGAGAGGAGGAGGAGGAGGG - Intergenic
999251332 5:150183985-150184007 GAACGTATGGAGGAGGAGGTGGG - Exonic
999451945 5:151685180-151685202 TAGAGCAAAGAGGGGGAGGGAGG - Intronic
1000409417 5:160922450-160922472 TAAAGAATGGAGGAGGATGTGGG + Intergenic
1000520055 5:162284106-162284128 TTGAGAAAAGAGGAGGAGTTAGG + Intergenic
1000778985 5:165456137-165456159 TGGTATAAGGGGGAGGAGGTTGG - Intergenic
1001168625 5:169394827-169394849 TAGAGAAAGGAGTAGGAAATGGG + Intergenic
1001330210 5:170756672-170756694 AAGGGTAAGGAAAAGGAGGTTGG + Intergenic
1001383671 5:171320360-171320382 TAGGCTAAGGAGGAGGAAGTGGG - Intergenic
1001433805 5:171683904-171683926 TAGGGCAAACAGGAGGAGGTGGG - Intergenic
1001732160 5:173968567-173968589 TAGAGAAAGAATCAGGAGGTGGG + Intergenic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1003097622 6:3154984-3155006 TTGACTATGGAGGAGAAGGTAGG + Intronic
1003101206 6:3177664-3177686 TTGACTATGGAGGAGGAGGTAGG + Intergenic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1003727450 6:8781198-8781220 ATGAGTATGTAGGAGGAGGTGGG + Intergenic
1004029997 6:11858992-11859014 TAGAGTCAGGAGTTGGAGGTAGG + Intergenic
1004446688 6:15706592-15706614 TAGGCTGAGGAGGAGGAGGGAGG - Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005083491 6:21980792-21980814 CAGAGCAGGGAGGAGGAGGTGGG - Intergenic
1005083646 6:21981668-21981690 CAGAGCAGGAAGGAGGAGGTAGG - Intergenic
1006303605 6:33206870-33206892 AAGGGAAAGGAGGGGGAGGTGGG - Intergenic
1006372226 6:33652191-33652213 TGGAGGAAAGAGCAGGAGGTGGG - Intronic
1006375561 6:33669975-33669997 GAGAGGGAGGAGGGGGAGGTGGG - Intronic
1007359253 6:41343283-41343305 TATAGATAGGAGGAGGAGGCAGG - Intronic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1008863244 6:56176929-56176951 AGGAGGAAGGAGGAGGAGGGAGG + Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1011514344 6:88136035-88136057 GAGAGTAATGAGGATGAGGGCGG - Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1013101062 6:106987142-106987164 TTGAGGGAGGAGGAGGAGGAGGG + Intergenic
1013914344 6:115316855-115316877 TAGAGACAGGAAGATGAGGTTGG + Intergenic
1014089852 6:117391431-117391453 CAGAGTGAGGAGGAGAAGCTGGG + Intronic
1014494367 6:122102254-122102276 AAGAGAAAGGAGGAGGAGAAAGG + Intergenic
1014804868 6:125818095-125818117 GAAAGTAAGGAGGAGGAGGAAGG - Intronic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1014871709 6:126604014-126604036 TAGACAGAGGAGGAGGAGGCAGG - Intergenic
1015227077 6:130869909-130869931 GAGAGTGAGGAGGAAGACGTGGG - Exonic
1015405716 6:132835009-132835031 TAGAGTAATAAGGAAGAGTTAGG - Intergenic
1015411062 6:132894425-132894447 TAGAGGAAGGAGGAGGGGGTTGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017586940 6:155936878-155936900 TAGAGAGAGAAGGAGGAGGGAGG + Intergenic
1017646932 6:156547877-156547899 TACAATAAGAAGTAGGAGGTTGG + Intergenic
1017704557 6:157110128-157110150 AAGAGTCAGGAGGATGAGTTTGG + Intronic
1017743473 6:157426996-157427018 TAGTGTCTGGAGGAGAAGGTAGG + Intronic
1018268968 6:162055582-162055604 CACAGAAAGGAGGAGGAGGGAGG + Intronic
1018387947 6:163321945-163321967 TAGAGTGAGGACGAGGGGCTGGG - Intergenic
1018434951 6:163751406-163751428 AGGAGGGAGGAGGAGGAGGTGGG - Intergenic
1019200361 6:170308779-170308801 AAGAGGAAGAAGTAGGAGGTAGG - Intronic
1019419071 7:942360-942382 AAGAGAGAGGAGGAGGAGGAAGG + Intronic
1019949924 7:4363126-4363148 CAGAGTAAGGAAGATGAGGAAGG - Intergenic
1020011513 7:4808084-4808106 GAGAGGAAGAAGGAGGAGGGAGG - Intronic
1020254165 7:6492773-6492795 TAGAGGAGGAAGGAGGAGGAGGG + Intergenic
1020254166 7:6492776-6492798 AGGAGGAAGGAGGAGGAGGGAGG + Intergenic
1020343195 7:7134766-7134788 TAGGATGAGGAGGAGGATGTTGG + Intergenic
1021029594 7:15714773-15714795 GAGAGAAAGGAGGAGAAGGAGGG + Intergenic
1021385875 7:20029287-20029309 TAGTGTCAGGAGGCTGAGGTGGG - Intergenic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1021923763 7:25514705-25514727 GAGAGTAAGGAGAATGAGTTTGG - Intergenic
1022052107 7:26686353-26686375 AAGAGAAAGGAGGAGGCAGTGGG + Intronic
1022217676 7:28280516-28280538 TAGAGTAAGCTGGAAGAGGTGGG - Intergenic
1022591585 7:31668988-31669010 TTGAGGAAGGAGAAGGAAGTAGG + Intergenic
1022972553 7:35530911-35530933 AGGAGTAAGGAGGAGGAAGCAGG - Intergenic
1023326823 7:39069820-39069842 TAGGTTGAGGAGGAGGAGGAAGG + Intronic
1024178141 7:46861785-46861807 GAGAGTTAAGAGGAGGAGGGTGG + Intergenic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1024770284 7:52714105-52714127 TAGATAAAGGAGGAGGATGAAGG - Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1025015635 7:55436889-55436911 TACAGTAAGGAGGAGGGTGGAGG - Intronic
1025715620 7:63953031-63953053 TAGAGTGAGGAGGCCCAGGTGGG + Intergenic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1026158947 7:67852194-67852216 TAGAATAAGGAAGATGAGGAGGG + Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026179249 7:68024114-68024136 TAGAGTAGGGAGGAGCTAGTGGG - Intergenic
1026205746 7:68255695-68255717 GAGAAGAAGGAGGAAGAGGTGGG - Intergenic
1026379010 7:69780526-69780548 TAGGGCAAAGAGGAGGAGGGCGG + Intronic
1026471079 7:70694493-70694515 GAGAGGGAGGAGGAGGAGGAGGG - Intronic
1026662088 7:72311113-72311135 TAGACTGAAGAGGAGGAGGAGGG - Intronic
1026800648 7:73397867-73397889 AAGAGTGAGGAGGAGGCGGGGGG + Intergenic
1026939755 7:74280683-74280705 GAGAGAGAGGAGGAGGAGGCTGG - Intergenic
1026989211 7:74573752-74573774 AAGAGGAGGGAGGTGGAGGTTGG + Intronic
1027645317 7:80790324-80790346 AGGAGAAAGGAGGAGGAGGAAGG + Intronic
1027974021 7:85125742-85125764 TAGAGTAGGAAGGAGGTTGTTGG - Intronic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028326581 7:89534307-89534329 TAGAAAAATGAGGAGGAGGCAGG + Intergenic
1028334029 7:89629083-89629105 TAGAGGAAGGTGCAGGTGGTGGG - Intergenic
1028754695 7:94421772-94421794 TAGACCAAGGAGTAGGAGGTAGG - Intronic
1028774633 7:94663469-94663491 GAGGGGGAGGAGGAGGAGGTGGG - Exonic
1028937758 7:96485428-96485450 CAGAGTGAGTAGGAGGAGTTGGG - Intronic
1029194550 7:98796016-98796038 TTCAGGAAGGAGGTGGAGGTGGG + Intergenic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1030172393 7:106616486-106616508 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1030176739 7:106661363-106661385 TAGAGTAAGAGGGTGGATGTTGG + Intergenic
1030704450 7:112676753-112676775 TAGAGGAAGTAGAAGGAGATTGG + Intergenic
1030735383 7:113041957-113041979 GAGATTTAGGAGGAAGAGGTGGG + Intergenic
1030796799 7:113798731-113798753 GAAAGGCAGGAGGAGGAGGTGGG + Intergenic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032281417 7:130505447-130505469 TATAGTAAGGAGGAGGAGAAGGG + Exonic
1032523167 7:132561500-132561522 GAGAAGGAGGAGGAGGAGGTGGG - Intronic
1032980462 7:137276302-137276324 TAGAGAAAGGAGGAAGAGCTGGG - Intronic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033598087 7:142870682-142870704 TAGAGTAAGCAGGGAGTGGTGGG + Exonic
1033706842 7:143897281-143897303 TAGGCTAAGGATGAGGAGGAAGG - Intronic
1034242212 7:149619294-149619316 TAGACTGAGGAGGAAGAGGAGGG - Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034380460 7:150687875-150687897 GAGAGTGAGGAGGAGGGAGTGGG - Intronic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1035161138 7:156950509-156950531 GAAAGTGAGGAGGAGGAGGAGGG + Exonic
1035208056 7:157307679-157307701 TACAGAAAGGAAGAGGAGTTGGG - Intergenic
1035416887 7:158696723-158696745 TGGACTTAGGAGGAGGAGGGTGG - Intronic
1035863711 8:3058885-3058907 TTCAGAATGGAGGAGGAGGTGGG - Intronic
1036053095 8:5222054-5222076 TAGGGTGAGGAGGAGGAGGAAGG + Intergenic
1036703927 8:11032470-11032492 TAGATTAGGGAGGAAGAGGTTGG + Intronic
1037147638 8:15592529-15592551 GAGAGTTAGGAGGAGGTGGCAGG - Intronic
1038164848 8:25075648-25075670 TAGAGAAAAGAGGAAGAGTTAGG - Intergenic
1038421010 8:27434063-27434085 GAGAGGAGGAAGGAGGAGGTTGG - Intronic
1038889364 8:31701575-31701597 TATAGTAAGGATGGAGAGGTAGG + Intronic
1038900842 8:31841994-31842016 TAGAATGGGGAGGAGGAGGAGGG - Intronic
1039468698 8:37800788-37800810 TAAAGTACGAAGGAGGAGTTTGG - Intronic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1040364022 8:46695569-46695591 TAGAGTAAAGAGGAAGGGGATGG + Intergenic
1040548728 8:48422317-48422339 TGGAGCCAGGAGGAGGAGGAGGG + Intergenic
1040911066 8:52519709-52519731 CAGAGTAAGTAGCAGGAGATGGG - Intergenic
1041291175 8:56310146-56310168 AGGAGGAAGGAGGAGGAGGAGGG + Intronic
1041291185 8:56310178-56310200 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041291224 8:56310303-56310325 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041957690 8:63574414-63574436 CAGAGGAAGGAAGAGGAGTTGGG - Intergenic
1042440402 8:68819794-68819816 TAGAGGAAGGATGAGGAGCTAGG + Intergenic
1042949784 8:74189145-74189167 GAAAGAAAGGAGGAGGAGGATGG - Intergenic
1043526062 8:81097539-81097561 CAGAGGCTGGAGGAGGAGGTGGG + Intronic
1044230127 8:89764987-89765009 TAGAATGAGGAGGTGGATGTGGG + Intronic
1044534707 8:93345488-93345510 GAGAGTGAGGTGGAGGAGTTGGG - Intergenic
1044620601 8:94187684-94187706 TGGAGCCAGGAGGAGCAGGTGGG - Intronic
1044745277 8:95365032-95365054 TTGAGCAGGGAGGAGGAGGCAGG + Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1044985527 8:97753315-97753337 GAGAAGAAGAAGGAGGAGGTCGG + Intergenic
1045648164 8:104319377-104319399 ATGAGGAAGGAGGAAGAGGTTGG + Intergenic
1045751291 8:105487222-105487244 TCGAGTAAGGAGGCTGCGGTGGG - Intronic
1046348304 8:112967395-112967417 GAGAGTAAGGTAGATGAGGTGGG - Intronic
1046654633 8:116879746-116879768 TATAGTAAGTAGGAGGAATTAGG + Intergenic
1046757148 8:117983825-117983847 CAGAGTATGGAGGACCAGGTAGG - Intronic
1046966833 8:120176866-120176888 GAGAATAAGGAGGAGAAAGTGGG - Intronic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1047174552 8:122528134-122528156 GAGAGTAAGGAGAATGAGCTGGG + Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1048276122 8:133067305-133067327 TAGAGAAAGGAGAAGCAGATGGG - Intronic
1048752663 8:137697637-137697659 TTGATTGAGGAGCAGGAGGTCGG - Intergenic
1048991248 8:139761520-139761542 TGGGGTTGGGAGGAGGAGGTGGG - Intronic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049353803 8:142177925-142177947 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1049684118 8:143932455-143932477 GAGAAGGAGGAGGAGGAGGTGGG - Exonic
1050610438 9:7346871-7346893 TGGAGGATGGAGGAGGAGGATGG - Intergenic
1050707632 9:8421249-8421271 GAGAGAAAGAGGGAGGAGGTTGG - Intronic
1051000739 9:12279139-12279161 TAGGGTAAAGAGGAGGAGTAAGG - Intergenic
1051444068 9:17121670-17121692 TAGAGTATGGAAGAGAAAGTAGG + Intergenic
1052879305 9:33591036-33591058 TAGGGTGGGGAGGAGTAGGTTGG + Intergenic
1053150640 9:35740691-35740713 AAGAGTAAGTAAGAGGAGCTGGG - Intronic
1053421902 9:37984986-37985008 TAGATAGATGAGGAGGAGGTGGG - Intronic
1053496673 9:38553182-38553204 TAGGGTGGGGAGGAGTAGGTTGG - Intronic
1054991469 9:71331945-71331967 AAGAGAAAGGTGGAGGAGGGAGG + Intronic
1055201454 9:73667392-73667414 TAGGGTGGGGAGGGGGAGGTGGG + Intergenic
1055266071 9:74497565-74497587 TGGACTGAGGAGGAGGAGGAAGG - Exonic
1055541858 9:77316902-77316924 TAGAGTTATGAAGAGGAGGAAGG - Intronic
1055581428 9:77711025-77711047 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1055811569 9:80154821-80154843 TAGAGTAAGGGGGTGCAGGCTGG + Intergenic
1055868231 9:80841605-80841627 TAGAGTGAGGAGGAGGGCTTTGG - Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056575955 9:87856321-87856343 CAGAGGTAGGAGGAGGAGCTGGG + Intergenic
1056844072 9:90022450-90022472 TTGTGTATGGAGGAAGAGGTGGG - Intergenic
1056972145 9:91214567-91214589 TGGAGTAAGAAGGATGAGTTTGG - Intronic
1057079868 9:92165361-92165383 TAGAGAAAGGGGAAGGAGATAGG + Intergenic
1057158293 9:92864782-92864804 CAGAGTAGGGAGGGGGAGTTGGG - Intronic
1057676585 9:97140742-97140764 TAGGGTGGGGAGGAGTAGGTTGG - Intergenic
1057929087 9:99178139-99178161 TAGAGGAAGGAGGCGAAGCTGGG + Intergenic
1058171547 9:101687048-101687070 CTGGGTAAGGAGGAGGAAGTCGG + Exonic
1058457206 9:105148668-105148690 GAAAGAAAGGAGGAGGAGGCAGG + Intergenic
1058561434 9:106233138-106233160 AGGAGAAAGGAGGAGGAGGAAGG - Intergenic
1058579687 9:106441415-106441437 GAGAGGAAGTAGGAGGAGGAAGG + Intergenic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1059072467 9:111152972-111152994 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059072471 9:111152985-111153007 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059179596 9:112199385-112199407 TAGAATAAGTAGGAGTAGGCTGG - Intergenic
1059363963 9:113770885-113770907 TAGAGTAAGGAGGTGATGGCAGG + Intergenic
1059588813 9:115635251-115635273 CAGAGGAAGGAGCAGTAGGTGGG - Intergenic
1059693811 9:116711874-116711896 TAGAGTTAGGAGGATCAGTTAGG - Intronic
1059737722 9:117118895-117118917 TAGAGTGAGGAGGTGGAGGAAGG - Intronic
1060105646 9:120871273-120871295 TACAGGAAGGAGAAGTAGGTGGG - Intronic
1060835351 9:126751556-126751578 AGGAGAAAGGAGGAGGAAGTGGG - Intergenic
1061012304 9:127962908-127962930 TAGGGTAAGTAGGTGGTGGTGGG - Intronic
1061053020 9:128207140-128207162 AAGAGTAAGGAGGAGCAGACTGG + Intronic
1061204130 9:129153214-129153236 GAGAGAAAGGAGGGTGAGGTTGG + Intergenic
1061645385 9:131996751-131996773 TAGAGTAAGGAGGAGGAGGTTGG - Intronic
1061892648 9:133630887-133630909 TAGATTAAGGACCCGGAGGTGGG - Intergenic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1202629276 M:3317-3339 TACAATGAGGAGTAGGAGGTTGG - Intergenic
1185545400 X:939789-939811 AAGAGAAAAGAGGAGGAGGGGGG - Intergenic
1185556667 X:1026921-1026943 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1185581546 X:1213681-1213703 AAGAGAAAGGAAGGGGAGGTGGG - Intergenic
1185661926 X:1735195-1735217 AGGAGGAAGGAGGAGGAGGAGGG - Intergenic
1185814493 X:3142397-3142419 AAGAAGAAGGAGGAGGAGGTGGG + Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1187025780 X:15434081-15434103 AGGAGAAAGGAGGAGGAGGGAGG + Intronic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1188494072 X:30765315-30765337 TAGAGGAAGGAAGAAGAGATGGG + Intergenic
1188518605 X:31013468-31013490 TAGAGTAAGGATGGGGTGGGAGG - Intergenic
1188786124 X:34348890-34348912 GAGAGACAGGAGGTGGAGGTGGG - Intergenic
1189322140 X:40093393-40093415 TAAAGAAAGGAAGAGGAGGGAGG + Intronic
1189351459 X:40278866-40278888 TAGATTAGAGGGGAGGAGGTGGG + Intergenic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1190248891 X:48707685-48707707 TAGAGCAGGTAGGAGCAGGTGGG - Exonic
1190429786 X:50367967-50367989 TAGAGTAAGGGGGAGTGGGAAGG + Exonic
1190463152 X:50698907-50698929 CAGAGTTAGGAGGAGGAAGGTGG - Intronic
1190881237 X:54494294-54494316 GAGAGAAAGGTGGAAGAGGTGGG - Intronic
1191141753 X:57121772-57121794 CAGACTAAGAAGGTGGAGGTGGG - Intergenic
1191779047 X:64847268-64847290 TGGAGTAATGAGGAGGAGAGGGG - Intergenic
1192054460 X:67758988-67759010 TGGAGGAAGGAGGCAGAGGTTGG + Intergenic
1192185181 X:68941831-68941853 AGGAGAAAGGAGGAGGAGGAAGG + Intergenic
1192336389 X:70223867-70223889 TAGAGAAAGGAGTAGGAAGTGGG - Intergenic
1192589405 X:72347350-72347372 GGAAGTAAGGAGGAGGAGGAGGG - Intronic
1195505327 X:105649928-105649950 GAAAGTAAGGAGGAGGAGAGAGG + Intronic
1196764111 X:119227306-119227328 TTGACTAAGGCAGAGGAGGTAGG - Intergenic
1197114170 X:122812657-122812679 TAGACTAAGGAGGAGAAAGAAGG - Intergenic
1197129704 X:122991091-122991113 TAGTGTAATGAGGTGGGGGTAGG - Intergenic
1197321239 X:125033558-125033580 TACAGTAAGTAGCAGGAGGAAGG + Intergenic
1197744374 X:129921263-129921285 GAGAGTGAGGAAGAGGAGGGAGG + Exonic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1197754033 X:129982745-129982767 GAGAGAGAGGAGAAGGAGGTCGG + Intronic
1197992380 X:132332060-132332082 TACAGTAAGGAGAAAGGGGTGGG - Intergenic
1198103417 X:133440926-133440948 TAGAGAAAGCAGGAGGGGATAGG + Intergenic
1198243127 X:134803716-134803738 TTGAGCAGGGAGTAGGAGGTGGG - Intronic
1198728132 X:139698344-139698366 TAGAGTCAGGAATAGGAGTTTGG + Intronic
1199218733 X:145292092-145292114 TAGATTAATGAGGAGGGAGTAGG - Intergenic
1199265077 X:145819107-145819129 GAGAGAAAGGTGGAGGTGGTTGG - Exonic
1199278666 X:145974564-145974586 TAGAGGAAGGTGGAGGTGGCGGG - Intergenic
1199599906 X:149535681-149535703 GCAAGTAAGGAGGAGGAGGGGGG - Intergenic
1199650728 X:149944567-149944589 GCAAGTAAGGAGGAGGAGGGGGG + Intergenic
1199665824 X:150095659-150095681 CAGAGTCAGGAGGAGGATGGTGG - Intergenic
1199941052 X:152628219-152628241 GACAGGAAGGAGGAGGAGGAAGG + Intergenic
1199955774 X:152741023-152741045 GGGAGTAAGGGGGAAGAGGTGGG + Intergenic
1200375179 X:155772717-155772739 TACAGTCAGGAAGAGGTGGTTGG - Intronic
1200845555 Y:7828910-7828932 TAGAGTGAGGAGGCCCAGGTAGG + Intergenic
1201601657 Y:15736143-15736165 TAGAGTAAGGATTAGGAAGTTGG + Intergenic
1202593925 Y:26516373-26516395 GAGAGTAAGGAGGTGGTGGAGGG + Intergenic