ID: 1061649874

View in Genome Browser
Species Human (GRCh38)
Location 9:132038871-132038893
Sequence CTCCGTTCGAAGCCCTGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061649874_1061649878 22 Left 1061649874 9:132038871-132038893 CCGTGGCAGGGCTTCGAACGGAG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1061649878 9:132038916-132038938 CTAAATGACACTCTGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061649874 Original CRISPR CTCCGTTCGAAGCCCTGCCA CGG (reversed) Intronic
904081805 1:27876962-27876984 CTCTGTTCCAAGCCCTGTCCAGG + Intronic
907052202 1:51337105-51337127 CTCTGCTCAAAGCCCTGCAAAGG + Intronic
911383086 1:97140331-97140353 CTACATTGAAAGCCCTGCCAAGG + Intronic
920050326 1:203160953-203160975 CTCCTATGGCAGCCCTGCCAGGG + Intronic
920190280 1:204189495-204189517 CTCAGATGGAAACCCTGCCATGG + Intergenic
920675084 1:208032987-208033009 ATCCTTTGGAAGCCCTGCCCAGG + Intronic
924615468 1:245608375-245608397 CTCTGTTGGAATCTCTGCCAAGG - Intronic
1063271573 10:4515177-4515199 CTCCGCTCAAAGCCCTGCAATGG + Intergenic
1070268045 10:74923794-74923816 CTCTGTTCAAAACCCTGCAAAGG - Intronic
1072799576 10:98383897-98383919 CTCCGCTCAAAAACCTGCCAGGG + Intronic
1080647939 11:34200451-34200473 CTTCGATCCAAGCCCTGCTATGG + Intronic
1081210477 11:40327233-40327255 CTCTGTTGAAAGCCCTGTCATGG - Intronic
1082924693 11:58532354-58532376 CTCCGCCCGCAGCCCTGGCATGG + Intronic
1082947014 11:58771537-58771559 CTCCTGTCTAAGCCTTGCCAGGG - Intergenic
1089160167 11:116431293-116431315 CTAGGTTCGAAGCCCTGGCCAGG + Intergenic
1099335202 12:81347562-81347584 CACCCCTCGAAGCCCTGCCAGGG - Exonic
1102928989 12:116848430-116848452 CTCTGCTCCAAGCCCTACCATGG + Intronic
1104000012 12:124854430-124854452 CTCCCCTCAAAGCCCTGACATGG - Intronic
1104977568 12:132559098-132559120 CTCGGATCGAGGCCCAGCCACGG - Intronic
1108114248 13:47110193-47110215 CTCCTGTCCAAGCCTTGCCAGGG + Intergenic
1122278730 14:100609286-100609308 CTCAGTTCCAGCCCCTGCCATGG + Intergenic
1122742875 14:103881993-103882015 CCCCGTTCCTGGCCCTGCCAGGG + Intergenic
1131087558 15:89589408-89589430 CTCCCTCCAAAGCCCTGCCCAGG + Intronic
1133097540 16:3457881-3457903 CTCCGTGCGAAGCCAGGCCCAGG - Intronic
1133277898 16:4649028-4649050 CTGCGCTCACAGCCCTGCCAAGG - Intronic
1134346549 16:13397246-13397268 CCCCATTACAAGCCCTGCCAGGG - Intergenic
1136922388 16:34343851-34343873 CTCAGGTGGAAGCCATGCCATGG - Intergenic
1136982185 16:35067955-35067977 CTCAGGTGGAAGCCATGCCATGG + Intergenic
1138395773 16:56703635-56703657 CTCTGTTCCAAACCCTTCCATGG + Intronic
1138937552 16:61747899-61747921 CTGTGTTCAAAGCCCTGCCCCGG - Intronic
1142611679 17:1111875-1111897 CTCACTTGGAAGCCCAGCCACGG + Intronic
1143590263 17:7881767-7881789 CTACCTTCCAGGCCCTGCCACGG - Intronic
1144373709 17:14618170-14618192 CTCGGGTCTCAGCCCTGCCATGG + Intergenic
1145883979 17:28370200-28370222 CTGAGCTAGAAGCCCTGCCATGG - Exonic
1147644667 17:42026697-42026719 CTCCTTTCGCAGGCCTTCCAGGG - Intronic
1155113262 18:22737361-22737383 CTCCGTGGGAAGCAGTGCCAAGG + Intergenic
1161390957 19:4019878-4019900 CTCGGCTCCCAGCCCTGCCAGGG - Intronic
1161943094 19:7418054-7418076 CTCTGCTCAAAGCCCTGCCATGG - Intronic
1163552501 19:17973621-17973643 CCCTGCTCAAAGCCCTGCCATGG - Intronic
1166365220 19:42274664-42274686 CTCCCCTTGAAGCCCTCCCAAGG - Intronic
925394372 2:3521906-3521928 CTCCGTGTGAAACACTGCCATGG + Intergenic
932490252 2:72115716-72115738 CTCCCTTCGAAGCCTGGCCCTGG + Intergenic
934056042 2:88252608-88252630 CTCTTTTGGAGGCCCTGCCAGGG - Intergenic
940293451 2:152099067-152099089 CTCCGTCCGCAGCCCAGCCTCGG - Exonic
1174098029 20:48105045-48105067 TTCAGCTCGAAACCCTGCCATGG + Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1181085415 22:20437422-20437444 CTCCGTTCCAGGCCCAGCCTCGG - Intronic
1182004159 22:26945092-26945114 CTCTGTACTAAGCCCTGACAAGG - Intergenic
1182015823 22:27038838-27038860 CTCAGCTCGAAACCCTCCCAAGG - Intergenic
1184271308 22:43385837-43385859 CTCAGTGCGAAGCCCGGCGATGG + Intergenic
961378109 3:126480439-126480461 CTCCATACCAAGCCATGCCAGGG - Intergenic
961779096 3:129311140-129311162 CTCAGCTCCAAGCCCTGCCCTGG + Intergenic
963716981 3:148813960-148813982 CTGCCTCTGAAGCCCTGCCATGG + Intronic
970142626 4:12998522-12998544 CTCCATGCAAAGCCCTGCTAAGG - Intergenic
978954093 4:114594562-114594584 CTCCTGTCTAAGCCTTGCCAAGG + Intergenic
984881495 4:184413506-184413528 CTCCAGTAGCAGCCCTGCCAGGG + Intronic
992080416 5:73230934-73230956 CCCCTTCCGAAGCCCTGCGAGGG + Intergenic
997625594 5:135328698-135328720 CTCCATTCCCAGGCCTGCCAAGG + Intronic
999241599 5:150131141-150131163 CTCTGCTCAAAACCCTGCCATGG + Intronic
999697961 5:154202963-154202985 CTGCCATCCAAGCCCTGCCAGGG + Intronic
1002314167 5:178332569-178332591 CGGAGTTTGAAGCCCTGCCAGGG - Intronic
1003415546 6:5904832-5904854 CTCCATACGGAGCCCTGCCTTGG + Intergenic
1003499725 6:6694499-6694521 CTCCATCGCAAGCCCTGCCACGG - Intergenic
1006931250 6:37689956-37689978 CTCTGCTCAAAACCCTGCCATGG + Intronic
1017845874 6:158257951-158257973 CTGTGGTCTAAGCCCTGCCACGG + Intronic
1022423943 7:30249653-30249675 CTCTGCTCAGAGCCCTGCCAGGG - Intergenic
1053307132 9:36992666-36992688 CTCAGCTCAAAGACCTGCCATGG + Intronic
1053463812 9:38290473-38290495 CTCCATTTGAAACCCTTCCATGG + Intergenic
1058179491 9:101779442-101779464 CTCTGTTCAAAGCCCTCCTATGG - Intergenic
1058600531 9:106665029-106665051 CTCAGTTTCAAGCCCTGCCTAGG + Intergenic
1059466541 9:114472244-114472266 CTCTGCTCAAAGCTCTGCCATGG + Intronic
1061649874 9:132038871-132038893 CTCCGTTCGAAGCCCTGCCACGG - Intronic
1190217493 X:48489560-48489582 CTCTGCTCGGAGCCCTGCCATGG - Intergenic
1191974849 X:66860953-66860975 CCCCGTTGTAAGCCCTGCAAGGG - Intergenic
1192568317 X:72181715-72181737 CCCCTTTAGAAGCCCCGCCATGG - Exonic