ID: 1061650274

View in Genome Browser
Species Human (GRCh38)
Location 9:132042215-132042237
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061650270_1061650274 18 Left 1061650270 9:132042174-132042196 CCTCTACAAATGAAGAGGCTGGC 0: 1
1: 0
2: 2
3: 6
4: 240
Right 1061650274 9:132042215-132042237 ATGGTGACGGCCATCACTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr