ID: 1061651834

View in Genome Browser
Species Human (GRCh38)
Location 9:132056814-132056836
Sequence CTGGAGCCAGCTCTTTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061651834_1061651836 -4 Left 1061651834 9:132056814-132056836 CCAGAACAAAGAGCTGGCTCCAG 0: 1
1: 1
2: 0
3: 17
4: 209
Right 1061651836 9:132056833-132056855 CCAGATGCTCTCTCAAAAAATGG No data
1061651834_1061651838 26 Left 1061651834 9:132056814-132056836 CCAGAACAAAGAGCTGGCTCCAG 0: 1
1: 1
2: 0
3: 17
4: 209
Right 1061651838 9:132056863-132056885 GATTCTTCATTCGGCTCATATGG No data
1061651834_1061651837 17 Left 1061651834 9:132056814-132056836 CCAGAACAAAGAGCTGGCTCCAG 0: 1
1: 1
2: 0
3: 17
4: 209
Right 1061651837 9:132056854-132056876 GGAACTAAAGATTCTTCATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061651834 Original CRISPR CTGGAGCCAGCTCTTTGTTC TGG (reversed) Intronic
901147125 1:7072812-7072834 CAGGAGCCTGCTGTCTGTTCAGG + Intronic
901564872 1:10105723-10105745 TTGGTGCCAGCTCTTTGTCTAGG + Exonic
902518128 1:17000645-17000667 CTGGAGCCAGGCCTTTCTCCTGG + Intronic
902635753 1:17734056-17734078 CAGGCGCCGGCTGTTTGTTCAGG - Intergenic
902776091 1:18675948-18675970 TTGGAGCCAGCTCCTGGTGCAGG - Intronic
902994219 1:20211313-20211335 TTGGAGCCAGGTCTCTGGTCAGG + Intergenic
903234850 1:21943392-21943414 CTGGTGCAAGCTCTTTGTGACGG + Intergenic
903301224 1:22379976-22379998 CTGGAGGCGGCTCATTCTTCTGG + Intergenic
903782433 1:25829703-25829725 CTGCAGGCAGCTTTGTGTTCTGG - Exonic
905848760 1:41257620-41257642 CTGGTGACATCTCTTGGTTCTGG - Intergenic
906022523 1:42642662-42642684 CTAGAACCATCTCTTTGTTGAGG - Intronic
906025216 1:42667777-42667799 CTGGAGCCAGGTCTTTCTAGGGG - Intronic
906191514 1:43902250-43902272 CAGGAGGCAGCTCTGTGTTCTGG + Intronic
906734397 1:48110687-48110709 CTGGTTCCTTCTCTTTGTTCAGG - Intergenic
910145430 1:84075272-84075294 CTAGAGCCACCTCTTTACTCAGG - Intergenic
911380208 1:97105208-97105230 CTTGGACCATCTCTTTGTTCTGG - Intronic
912555421 1:110512655-110512677 CCGGAGCCTGCTCCTTGTTGGGG + Intergenic
912863091 1:113232434-113232456 CTGGAGCCAGATCTCTGTGATGG + Intergenic
913506333 1:119519232-119519254 CTTGACCCAGCTCTTGGCTCTGG - Intergenic
916267416 1:162904644-162904666 CTGGAGTAAGCCCTTTCTTCTGG - Intergenic
919790854 1:201290020-201290042 CTGGAGGCAGCTCCTTCTTTAGG - Intronic
1067722940 10:48743362-48743384 CTGGAGGCAGCTCTGTATCCGGG - Exonic
1068410759 10:56651169-56651191 CTAGAGCCAGCTCAATGTTCAGG - Intergenic
1069630016 10:69891949-69891971 CAGCAGCCAGCACTTTGTCCTGG + Intronic
1069778314 10:70939527-70939549 CTGGAGCTAGCTCTCCCTTCAGG - Intergenic
1070796744 10:79221376-79221398 CAGCCCCCAGCTCTTTGTTCTGG + Intronic
1071517253 10:86306352-86306374 GTGGAGAAAGCTCTTTGTTCAGG + Intronic
1076893369 10:133296075-133296097 CTGCAGCCAGCTCTCAGGTCAGG - Intronic
1077323812 11:1954739-1954761 CTGGCGGCAGCGGTTTGTTCTGG - Intronic
1078860410 11:15241263-15241285 CAAGAGCCAGCACTTTCTTCTGG - Intronic
1080410420 11:32018876-32018898 CTGGAGCCAGCTCTGCCTTTGGG + Intronic
1083647275 11:64179520-64179542 CTGGAGCCCGCACTATGTTGCGG + Intergenic
1084979818 11:72823039-72823061 TTGGAGCCAGCTCTTGGGTTGGG + Intronic
1085308908 11:75504488-75504510 CTGGATCCCCTTCTTTGTTCAGG - Intronic
1085324646 11:75597212-75597234 CTGGGGCCAGCCCCTAGTTCAGG + Intronic
1086224346 11:84489618-84489640 CTGGAGCCAGCGTTTTGCTTTGG - Intronic
1087849023 11:103006947-103006969 GTGGAGCCAACTGGTTGTTCTGG - Intergenic
1088716890 11:112556369-112556391 CTGGAACCAACTCTTTGCTCTGG - Intergenic
1089339451 11:117747625-117747647 CTGAAGCCAGCTCATTCTTCTGG - Intronic
1090045321 11:123327024-123327046 CTCTAGCAAGCTCTTTGTTAAGG + Intergenic
1090459031 11:126873693-126873715 CTGGAGGCAGCTCTTCTTTGTGG - Intronic
1202806798 11_KI270721v1_random:9934-9956 CTGGCGGCAGCGGTTTGTTCTGG - Intergenic
1091656444 12:2349981-2350003 CTGGGGCCACCCCTTTGTCCTGG - Intronic
1093308220 12:17544955-17544977 CTGGACCCAACTGTGTGTTCAGG - Intergenic
1095671730 12:44869336-44869358 CTGGAGTCAGCTCCATGCTCTGG + Intronic
1098353208 12:69585290-69585312 CGGCAGCCGCCTCTTTGTTCTGG + Intergenic
1099717261 12:86311569-86311591 ATGAAGCCAGCTCTGTGTGCAGG - Intronic
1100501297 12:95176458-95176480 GTAGAGCCCACTCTTTGTTCTGG - Intronic
1101217840 12:102602833-102602855 CTAGAGCCTGCTCTGTGTTTAGG - Intergenic
1102310723 12:111842490-111842512 CTGGGGACAGGTCTTTGTGCTGG - Intronic
1102573012 12:113839036-113839058 CTGCAGAGAGCTCTTTGTTGTGG + Intronic
1104908725 12:132229345-132229367 CTGGAGGCTGCTCTGGGTTCAGG - Intronic
1106064163 13:26328382-26328404 CTGGTGCAAGCTCCTTGATCTGG + Intronic
1106824929 13:33509965-33509987 GTGGAGGGAGTTCTTTGTTCAGG - Intergenic
1107254293 13:38405147-38405169 CTGAAGCCATCATTTTGTTCTGG + Intergenic
1113518967 13:110924767-110924789 CTGGACCCAGCTCTGTCTGCTGG + Intergenic
1113644132 13:111980382-111980404 CCGGAGCCAGCTGTTAGGTCAGG + Intergenic
1118667680 14:68087589-68087611 ATGGAGCCAGATTTTTTTTCTGG - Intronic
1119967422 14:78932267-78932289 CTGCAGTCAGCACTTTGATCAGG + Intronic
1120093308 14:80359146-80359168 CTATAGCCAGATCTTTCTTCTGG - Intronic
1123216171 14:106811054-106811076 CTGGGTCCTGCTCTTTCTTCAGG - Intergenic
1128328579 15:66741207-66741229 CTGTAAGCAGCTCTCTGTTCAGG + Intronic
1128471190 15:67954939-67954961 CTTCTGCCAGCTCTTTCTTCAGG + Intergenic
1128716403 15:69911611-69911633 CAGGAGACAGCTCTCAGTTCTGG + Intergenic
1129321980 15:74780589-74780611 CTGGAGCCAGCCCTTTGGAGAGG - Intergenic
1129629276 15:77240073-77240095 CTGGAGACAGCTCCATTTTCAGG + Intronic
1130027889 15:80285585-80285607 CTGGAGCCTGCCCCTTGTGCAGG - Intergenic
1130246104 15:82250753-82250775 TTGGAGCCAGATTTTTATTCTGG - Intronic
1130759736 15:86806144-86806166 TTGGAGCCAGCTCTTCCTCCAGG + Intronic
1130827800 15:87567313-87567335 CTGGAATCAGCTTTGTGTTCTGG + Intergenic
1132467863 16:85888-85910 CTGGAGCTAGCTCTTCCTCCAGG + Exonic
1132486051 16:191920-191942 CTGGAGACAGCTCATTGTCCAGG - Intronic
1132801926 16:1758781-1758803 ATGGAGCCAGCTATTCCTTCTGG - Intronic
1132873632 16:2126274-2126296 CGGAAGCCAGCTCTTCCTTCTGG - Intronic
1132896913 16:2233555-2233577 CTGGAGCCAGCTCCTGCTGCCGG + Exonic
1134552719 16:15145448-15145470 CGGAAGCCAGCTCTTCCTTCTGG - Intergenic
1135584927 16:23662569-23662591 ATGGAGCCAGCTCTCTGCCCTGG + Intronic
1137398428 16:48133670-48133692 CTGGAGCCAGCTCTTACCACGGG + Exonic
1137816483 16:51402626-51402648 CTGTGGCCAACTCTTTTTTCTGG + Intergenic
1138335778 16:56251852-56251874 CTGGAGCCAGCTCTTGATCAGGG - Intronic
1142082559 16:88157840-88157862 CAGGTGCCAGCACTTTGTACGGG - Intergenic
1144770230 17:17755541-17755563 CAGGAGAGAGCTCTTTGTTTGGG + Intronic
1145935880 17:28714523-28714545 CAAGAGGCAGCTCTTTGGTCTGG + Exonic
1146260495 17:31417245-31417267 CTGGGGCCAGATCCTTGCTCAGG - Intronic
1146542674 17:33711209-33711231 CTGGAGCCCATTCTTTCTTCAGG + Intronic
1149854895 17:60073674-60073696 CTGGTGCCAACACTGTGTTCAGG - Intronic
1150589990 17:66553846-66553868 CTGGTGCCATCTCATTGTTCAGG + Intronic
1151670852 17:75570988-75571010 CAGGCGCCAGCTCCATGTTCTGG - Exonic
1152359515 17:79824901-79824923 CTGAAGCCAGCCCTTTCTCCTGG - Intergenic
1152495571 17:80669028-80669050 CTGCAGCCAGGGCTTTGCTCGGG + Intronic
1154361106 18:13661641-13661663 ATGAAGCCTGTTCTTTGTTCCGG - Intergenic
1155324308 18:24650629-24650651 CTTGAGCCAGTTCTCAGTTCAGG - Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1157539428 18:48489220-48489242 CAGGAGCCAGCTCTCTGCTTGGG - Intergenic
1157606906 18:48931737-48931759 CAGGAGCCATTTCTGTGTTCTGG - Intronic
1158698552 18:59725465-59725487 TTTGAGCCAGTTCTTTGTTGTGG + Intergenic
1159310363 18:66699704-66699726 CGTGAACCAGCTCTTTGTCCAGG - Intergenic
1162492076 19:10998860-10998882 CTGGAGCCAACTCTTTCTCCAGG + Intronic
1162493720 19:11010994-11011016 CTGGACTCCGCTCTTTCTTCTGG + Intronic
1164303510 19:23982863-23982885 CTGGACTCAGCTTTTGGTTCAGG + Intergenic
926160717 2:10487560-10487582 CTGGAGCCAGTTCTTTCCTCCGG + Intergenic
926755078 2:16227930-16227952 CTGCCCCCAGCTCTGTGTTCAGG - Intergenic
929420058 2:41781292-41781314 CTGGGGATAGCTCTTAGTTCAGG - Intergenic
930030722 2:47056591-47056613 CTGGAACCAGCTCTGGGTGCAGG + Intronic
931285218 2:60826448-60826470 CTGGACCCAGCTCATGGTGCAGG - Intergenic
933811835 2:86037411-86037433 CTCGAGCCAGCCCTCTGTGCAGG - Intronic
934012268 2:87835556-87835578 GTGGAGCCCTGTCTTTGTTCAGG - Intergenic
937941854 2:127292379-127292401 CTGGATCCAGCATTGTGTTCTGG - Intronic
937941861 2:127292434-127292456 CTGGATCCAGCATTGTGTTCTGG - Intronic
939872206 2:147538184-147538206 CTGGACCCAGTTCTTTGTAGGGG - Intergenic
940006980 2:149016899-149016921 CTGGTGCCACCTCTTTTCTCTGG - Intronic
940073912 2:149719604-149719626 CTGCTGCTAACTCTTTGTTCTGG - Intergenic
940485619 2:154291696-154291718 CGGGAGCCAGCTCCCTGGTCTGG - Intronic
942070690 2:172312918-172312940 CTGAAGTCTGCCCTTTGTTCTGG - Intergenic
943165469 2:184318076-184318098 CTGCAGCCAGCTCTATTTTGCGG + Intergenic
944395055 2:199257390-199257412 CTGGAGCAAGCTCTCTCTGCGGG + Intergenic
944539377 2:200741593-200741615 CTGGAGCCAGGGCTGTGCTCTGG - Intergenic
1168805684 20:671134-671156 CTGGACCCAGCACTTTGCCCTGG + Intronic
1168910600 20:1443811-1443833 CATCAGCCAGCTCTTTGTTCGGG + Exonic
1169211382 20:3767838-3767860 TTGGAGCCCGCTCATTGGTCCGG - Intronic
1172887151 20:38239092-38239114 CTGGAGCCAGCTCTGTGGGGCGG + Intronic
1172929503 20:38574892-38574914 CTGGCTCCAGCTGCTTGTTCCGG - Exonic
1173753023 20:45491675-45491697 ATGGACACAGCTCTCTGTTCCGG - Intergenic
1175933078 20:62502561-62502583 CTGGGGCCAGCTCATGCTTCTGG + Intergenic
1178302758 21:31466642-31466664 CTGGATTCTGCTCTTTGCTCTGG - Intronic
1179558495 21:42195689-42195711 CTGGAAACAGCTGTGTGTTCAGG + Intergenic
1179616071 21:42584203-42584225 CTGAAGCCAGCTCTTGTTGCTGG + Intergenic
1179997939 21:44982445-44982467 CTGGAGTCAGCTCTGTGTGCAGG - Intergenic
1180946226 22:19695267-19695289 CTGGTGTCAGGCCTTTGTTCAGG - Intergenic
1181621472 22:24094396-24094418 TTGGAGCCAGCACTGTGTGCTGG - Intronic
1182427901 22:30284506-30284528 CTGGAGCCTGCTCTGTCCTCCGG - Intergenic
1183883198 22:40854687-40854709 GTGGAGCCAGCTCTTGGAGCCGG + Intronic
1184001155 22:41674602-41674624 CTGGAACCAGATCTCTGTCCTGG + Exonic
1184198325 22:42947172-42947194 CAGGAGGCTGCCCTTTGTTCAGG + Intronic
1184250352 22:43256713-43256735 TTGGAGCCAGCTCTGTGGCCCGG - Intronic
951115048 3:18851286-18851308 CTGGAACCAGCTATTTCTTTAGG - Intergenic
951705158 3:25537029-25537051 CCGGAGTCAGCTTTTTGATCCGG - Intronic
953272282 3:41457441-41457463 CTGTAGCCTTCTCTTTCTTCTGG - Intronic
954452491 3:50579351-50579373 CTGGGGCCAGCTTTTAGTCCCGG - Intronic
958022485 3:88014739-88014761 CTAGAACCAGCTATTTCTTCAGG + Intergenic
960086241 3:113594623-113594645 CTTGAGCCAGATCATTGTCCAGG + Intronic
960571509 3:119189268-119189290 CTGTAGCCAGAGCTTTATTCTGG + Intronic
961472014 3:127121316-127121338 CTGGAGCCAGCACTGTCTGCTGG - Intergenic
962632552 3:137294225-137294247 CTGAAGCCCACCCTTTGTTCCGG + Intergenic
963810916 3:149775536-149775558 CTGGAGCCAGCTCAGATTTCAGG + Intronic
968188950 3:196653525-196653547 CTGGGGCCAGCTCTTGCCTCTGG + Intronic
969138484 4:5050099-5050121 TAGGGGCCAGCTCTGTGTTCAGG + Intergenic
969658414 4:8510964-8510986 CTGGTGCCAGCTCATTCCTCAGG - Intergenic
971022158 4:22547836-22547858 ATGGAGCCAGAATTTTGTTCTGG - Intergenic
974326219 4:60418714-60418736 CTGCTGCCTGCTCTTTCTTCTGG + Intergenic
976690180 4:87860446-87860468 CTGGATACAGATCTTTTTTCTGG + Intergenic
978178375 4:105762369-105762391 TTGGAGTCAGTTATTTGTTCTGG + Intronic
978570817 4:110134935-110134957 CTGGAGACAGGGCCTTGTTCTGG - Intronic
982991769 4:162285876-162285898 CTGGAGCCAGTTCTCAGCTCTGG + Intergenic
984420827 4:179518786-179518808 TTGGAGCCAGCCCATAGTTCTGG + Intergenic
984862432 4:184252902-184252924 CTGGAGCCAGCTCCCTCTGCTGG + Intergenic
985702231 5:1380529-1380551 CTGGAGCCAGCTCCCTCTGCTGG - Intergenic
985721285 5:1490535-1490557 ATGCGGCCAGCACTTTGTTCTGG + Intronic
986044596 5:4025045-4025067 GTGGAGTCATCTCTTTATTCTGG - Intergenic
986199689 5:5569840-5569862 CCGGAGGCAGCTCATTGCTCGGG - Intergenic
990738341 5:58888136-58888158 CTGAAGCCAGACCTTTGTTCTGG + Intergenic
992017512 5:72590666-72590688 CTGTAGCTAGCTCTTGGTTGTGG + Intergenic
992221433 5:74577466-74577488 CTCTAGCCATCTCTTTGTTTTGG + Intergenic
996977086 5:129447962-129447984 CTAGAGCCACCTATTTTTTCTGG - Intergenic
997040827 5:130251498-130251520 CTGGAGCCAGCATTTTGGACGGG - Intergenic
997529830 5:134575156-134575178 CAACAGGCAGCTCTTTGTTCAGG + Intronic
999488732 5:152026984-152027006 CTGGCGTCAGCCCTTTTTTCAGG + Intergenic
1004482344 6:16032820-16032842 TGGGAGGCAGGTCTTTGTTCAGG + Intergenic
1004753707 6:18588880-18588902 CTGGACCTAGCTGTTTGTTAAGG + Intergenic
1005109981 6:22270516-22270538 CTGGATCCAGGTCTGTGCTCAGG - Intergenic
1006569075 6:34985368-34985390 CTGGTGCCAGCTCATGTTTCCGG + Intronic
1006831434 6:36970546-36970568 CTGGAGGCAGGTCTTGGTACAGG - Intronic
1007019976 6:38509853-38509875 GGGTAGCCAGCTCTTTGATCAGG - Intronic
1007455904 6:41976894-41976916 CTTGAGGCTGCTGTTTGTTCAGG + Intronic
1008077095 6:47156324-47156346 CTGGAGCATTCTCTTCGTTCTGG + Intergenic
1009557441 6:65191719-65191741 CTAGAGATAGCTCCTTGTTCAGG - Intronic
1011782621 6:90807181-90807203 CTGTAGGCAACTCTTTTTTCTGG - Intergenic
1012146191 6:95686044-95686066 CTGGAGTCAGCTCTTCCTCCTGG + Intergenic
1018438063 6:163781373-163781395 CTGGAGCCAGCAATTTACTCTGG - Intergenic
1018852018 6:167647617-167647639 CTGGGGCCAGCGATTAGTTCTGG + Intergenic
1022634729 7:32120512-32120534 CTGGTGCCTGCTCCTTCTTCTGG - Intronic
1023337654 7:39186936-39186958 CTGCCGCCTGCTCTGTGTTCTGG + Intronic
1023996616 7:45162508-45162530 CTGGAGACAGCTCTGTGGGCAGG + Intronic
1024181491 7:46899824-46899846 CTGGAGACAGTTCTTTGTGAGGG - Intergenic
1024348250 7:48335310-48335332 CTGCAGGCAGATCTTTGCTCTGG + Intronic
1025011164 7:55400053-55400075 CTGGACCTATCTCTGTGTTCAGG - Exonic
1029227377 7:99038003-99038025 CTTGAGGCAGATCTGTGTTCAGG - Intronic
1030305398 7:108013207-108013229 CAGGTGCCAGCTCTGTGTTTAGG - Intergenic
1031991591 7:128202395-128202417 CTGGAGCCTGATCTTTCTCCTGG - Intergenic
1032683449 7:134208867-134208889 CCTGAGCCAGCTCTTGGTTCTGG - Intronic
1032976173 7:137225855-137225877 TTTGAGCAAGCTCTCTGTTCTGG - Intergenic
1034301012 7:150015372-150015394 CTGGAGCCACCTCTTTCTTGGGG - Intergenic
1034805040 7:154081930-154081952 CTGGAGCCACCTCTTTCTTGGGG + Intronic
1035076519 7:156181143-156181165 CTGCAGCCAGCTCCTTGCTCTGG + Intergenic
1035425259 7:158767008-158767030 CTGCAACCAGCTCTGTGTGCTGG + Intronic
1036741890 8:11370677-11370699 TTGGAGGCAGCTACTTGTTCTGG - Intergenic
1036786524 8:11691694-11691716 CTGGAGGGAGCTCCTTGGTCTGG - Intronic
1038227667 8:25671647-25671669 CTGGAGCGAGGTCTTGGTCCTGG + Intergenic
1039628588 8:39082559-39082581 CTGTACCCAGGTCTTTTTTCTGG + Intronic
1040447546 8:47511094-47511116 CGTCAGCCAGCTCTTTGTTTGGG + Intronic
1041717562 8:60945831-60945853 CTAAATCCAGTTCTTTGTTCAGG + Intergenic
1044347320 8:91120444-91120466 CTGGAACCACCTCTTTATCCAGG - Intronic
1046694696 8:117326605-117326627 AAGGAGCCAGCTGTTAGTTCAGG - Intergenic
1047523279 8:125612089-125612111 CTGCAGCAAGCTCTGAGTTCTGG - Intergenic
1047710067 8:127542699-127542721 CTGGTGCCAGCTGTTTGTTGGGG - Intergenic
1048558874 8:135510874-135510896 CTGGAGCCATCTCAGTGTACTGG + Intronic
1048703063 8:137115960-137115982 CTGGAGCCGGCTCTCTCTGCTGG - Intergenic
1049277100 8:141725348-141725370 CTGGAACCAGCTCTTCCTGCTGG + Intergenic
1052798960 9:32949812-32949834 CTGGCACCAGCTCTTTTTTAAGG + Intergenic
1055404708 9:75962442-75962464 CTGGAGCCAGCTGGATGTTGAGG + Intronic
1055454947 9:76463616-76463638 CTGGAGCAACCTATTTATTCAGG + Intronic
1056788574 9:89610705-89610727 CTGGCGCCAGCTCTCTGGCCTGG + Intergenic
1058422510 9:104845521-104845543 CTTCAGCCAGCTCCTTGCTCGGG + Exonic
1059252802 9:112902321-112902343 GTGGTCCCAGCTCTTTGCTCTGG - Intergenic
1060239241 9:121888647-121888669 CTGAAGCCATATCTTTGTGCAGG - Intronic
1061651834 9:132056814-132056836 CTGGAGCCAGCTCTTTGTTCTGG - Intronic
1062008868 9:134256408-134256430 TTGGAGTTAGCTCTTTGTTGAGG + Intergenic
1062175527 9:135160050-135160072 GTGGAGCCAGCGCTTTGCACAGG - Intergenic
1187360332 X:18620540-18620562 ATGGAGCCAGCTCTTTGTTCAGG - Intronic
1190289398 X:48982290-48982312 CTGGAGCCAGTTGTTTGTCTAGG - Intronic
1191791736 X:64978441-64978463 CTGGGGCCAGTTCTTGGCTCTGG - Intronic
1193962218 X:87939945-87939967 CTGGAGCCAGCTCCCTCTGCTGG - Intergenic
1196938724 X:120754863-120754885 CTGAATCAAGATCTTTGTTCTGG - Intergenic
1197207441 X:123801980-123802002 TTGGGGCCAGATCTTGGTTCTGG - Intergenic
1198791888 X:140355073-140355095 CTGGGGCCAGCTCACTGTCCAGG - Intergenic
1199132215 X:144202985-144203007 GTGGAGCCCTGTCTTTGTTCAGG + Intergenic
1200011058 X:153121165-153121187 GTAAAGCCAGCTCCTTGTTCTGG - Intergenic
1200028541 X:153278757-153278779 GTAAAGCCAGCTCCTTGTTCTGG + Intergenic