ID: 1061653713

View in Genome Browser
Species Human (GRCh38)
Location 9:132071116-132071138
Sequence GGTGTTATGAGGACAAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 0, 2: 7, 3: 63, 4: 465}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061653713_1061653717 -10 Left 1061653713 9:132071116-132071138 CCTCATTTTGTCCTCATAACACC 0: 1
1: 0
2: 7
3: 63
4: 465
Right 1061653717 9:132071129-132071151 TCATAACACCTTTCTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061653713 Original CRISPR GGTGTTATGAGGACAAAATG AGG (reversed) Intronic
900897608 1:5494636-5494658 TGCTTTATTAGGACAAAATGTGG - Intergenic
902045024 1:13517692-13517714 GTTGTTACGAGGATGAAATGAGG + Intergenic
902151265 1:14445335-14445357 GCTTTTAAGAGGAGAAAATGTGG + Intergenic
902362775 1:15951154-15951176 GGTGTTAGGAGGAGAAACAGAGG + Intronic
902466717 1:16623089-16623111 CATGTTATGAAGACAAAATGAGG - Intergenic
902507893 1:16949681-16949703 CATGTTATGAAGACAAAATGAGG + Intronic
902871801 1:19318113-19318135 GTTGTTGTGAGGATTAAATGAGG - Intronic
903558202 1:24208527-24208549 GTTGTTGTGAGGATTAAATGAGG + Intergenic
903670058 1:25030155-25030177 GCTATCATGAGGACTAAATGAGG + Intergenic
903711044 1:25324717-25324739 GCTGTTGTGAGGATAAAATCAGG - Intronic
903859753 1:26357462-26357484 GGTGTGGTGGGGGCAAAATGAGG - Intergenic
903938996 1:26915693-26915715 GCTGCCATGGGGACAAAATGAGG + Intronic
904092036 1:27951950-27951972 GTTGTTATGAGGATTAAATAAGG + Intronic
904694753 1:32322930-32322952 GTTGTTGTGAGGATCAAATGAGG + Intronic
904813147 1:33176846-33176868 GGTGCTATGAAGATTAAATGAGG + Intronic
905309858 1:37041842-37041864 GCTGTTGTGAGGATTAAATGAGG + Intergenic
905520821 1:38598114-38598136 AGTGCTATGAGGATTAAATGTGG - Intergenic
905793754 1:40803840-40803862 GGTGGTTTGGGGACACAATGAGG - Intronic
906753345 1:48285935-48285957 GGTGTCAAGAATACAAAATGTGG - Intergenic
907284078 1:53369197-53369219 GCTGGTATGTGGACTAAATGAGG + Intergenic
907653773 1:56321716-56321738 AGTGTTATGTGGACTAAATAAGG + Intergenic
907819694 1:57954847-57954869 ACTGTTATAAGGATAAAATGAGG - Intronic
907889183 1:58621451-58621473 GTTGTTGTGAGGATTAAATGTGG + Intergenic
908463671 1:64370377-64370399 GGGGTTAGGAGGAAAACATGTGG + Intergenic
908597351 1:65702711-65702733 GTTGTCGTGAGGAAAAAATGAGG - Intergenic
908685625 1:66716000-66716022 CCTGTTCTGAGGATAAAATGAGG - Intronic
909469016 1:76005620-76005642 GGTGTGATGGGGTCAGAATGAGG + Intergenic
910596667 1:88988009-88988031 GGTTTTGTGAAGACAAAATGAGG + Intronic
911626099 1:100126317-100126339 GATGTTTTGAGGATTAAATGAGG + Intronic
912502382 1:110130724-110130746 GTTGTTTTGAGGACTAAATGAGG - Intergenic
912506254 1:110158567-110158589 GTTGTCATGAGTATAAAATGAGG - Intronic
913084867 1:115427487-115427509 AGTTTTATGAGGATTAAATGAGG + Intergenic
914350133 1:146833344-146833366 GTTGTTGTGAGGGCAAAAGGAGG - Intergenic
915082264 1:153360319-153360341 GTTGTTATAAGGACCAAATGAGG + Intronic
915412779 1:155715669-155715691 TGTGTTATGAGGAAAAGATTAGG - Intronic
915985894 1:160464031-160464053 GCTGTTGTGAGGATAAAATGAGG + Intergenic
916141812 1:161706276-161706298 GGTGTTATGATGACAGAAAGGGG + Intergenic
916569306 1:166010928-166010950 TGGGTGCTGAGGACAAAATGAGG - Intergenic
917031809 1:170700999-170701021 GCTGTTATGAGGAATAAATGAGG + Intronic
917202942 1:172536490-172536512 GTAGGTATGAGAACAAAATGTGG - Intronic
917516413 1:175712148-175712170 GTTGTTATGAGAAGCAAATGAGG - Intronic
917552406 1:176047299-176047321 GTTGTTATGAGGACTAAATGAGG - Intronic
917712818 1:177704509-177704531 GGTGTTATGAAGAATAAATGAGG - Intergenic
918245496 1:182656035-182656057 GCTGTTATAAGGATTAAATGAGG + Intronic
918335038 1:183501237-183501259 GGTGTTTTGAGGATTAAATGAGG - Intronic
919406940 1:197197122-197197144 GTTATTATGAGGATTAAATGGGG - Intronic
919723737 1:200867592-200867614 GGTGTTGTGAAGATCAAATGAGG - Intergenic
920259825 1:204681413-204681435 GCTGTCATGAGGACTACATGAGG - Intronic
921332344 1:214051860-214051882 CTTGTTATGAGGATTAAATGTGG + Intergenic
922084303 1:222331275-222331297 GTTGTTGTGAGGATTAAATGAGG - Intergenic
923462640 1:234220507-234220529 CATGTTGTGAGGACTAAATGAGG - Intronic
924908883 1:248487819-248487841 GGTGTGGTGAGGGTAAAATGAGG - Intergenic
924915223 1:248560239-248560261 GGTGTGGTGAGGGTAAAATGAGG + Intergenic
1063786987 10:9395903-9395925 GTTGTTATGAGGTTTAAATGAGG - Intergenic
1064202276 10:13294921-13294943 GTTGTTATTAGGACTAAATACGG - Intronic
1064335301 10:14435187-14435209 GGTGGGATGAGGGCAAAAGGGGG + Intronic
1065137886 10:22690676-22690698 GCTATTAAGAGGACAGAATGAGG - Intronic
1066010589 10:31190570-31190592 AGTTTGCTGAGGACAAAATGTGG + Intergenic
1068655682 10:59573691-59573713 GTTGTGAGGAGGAGAAAATGAGG + Intergenic
1069611399 10:69774951-69774973 GGCTTTAGGAGGAAAAAATGTGG - Intergenic
1069625327 10:69864230-69864252 GTTGTTATAAAGACAAAGTGCGG + Intronic
1070287434 10:75094203-75094225 GGTATGAGGAGGACAAGATGAGG + Intergenic
1070518251 10:77227891-77227913 GATGTTATGAGGATTAAATGAGG + Intronic
1071449526 10:85780809-85780831 GGTGTTCTGAGGATTAAATTAGG + Intronic
1071679528 10:87690788-87690810 ACTGTTATGAGGATTAAATGAGG - Intronic
1072104385 10:92260095-92260117 GTTGTTAAGAGGGCAAATTGTGG + Intronic
1072467970 10:95684706-95684728 GGTGTTATTATAACTAAATGAGG + Intronic
1072741028 10:97909484-97909506 GGTTTTGAGAGGACCAAATGAGG + Intronic
1072766637 10:98099790-98099812 GGGATTATGAGAACAAATTGAGG - Intergenic
1073118043 10:101103484-101103506 GAGGTTATGAGGAACAAATGAGG + Intronic
1073336217 10:102711811-102711833 GATGCTATGAGGATGAAATGAGG + Intronic
1073629489 10:105134238-105134260 GTTGTTATGAGGATTAAATTAGG + Intronic
1074572657 10:114638460-114638482 GTTGTTATGAGGACAAGATGAGG - Intronic
1074859573 10:117500009-117500031 GGTTTTCTGAGGAATAAATGAGG + Intergenic
1074861357 10:117512620-117512642 GTTGTTATGAGGACTAAATGAGG + Intergenic
1075019397 10:118939809-118939831 GGTGAGATGAGGAGGAAATGGGG + Intergenic
1075143054 10:119857511-119857533 GGTGTTATAATGTGAAAATGTGG - Intronic
1075288207 10:121205216-121205238 GGTGGTATGAGGACTAAATGGGG - Intergenic
1075479471 10:122767705-122767727 GTTGCTCTGAGGACTAAATGGGG - Intergenic
1077659861 11:4057922-4057944 GTTGTTGTGAGGACTGAATGAGG + Intronic
1077765444 11:5154834-5154856 GGAGTTATGAGCATGAAATGAGG + Intronic
1078409768 11:11104797-11104819 GTTATTATGAGGATTAAATGAGG + Intergenic
1078504252 11:11919064-11919086 TGTGTTCTGAGAACAAAATAGGG + Intronic
1078512940 11:11999001-11999023 GTTGCTATGAGGAGGAAATGAGG + Intronic
1079311324 11:19368567-19368589 GTTGTTATGAGGATTAGATGAGG + Intronic
1079638167 11:22771449-22771471 GGTGTCAGGAGCAAAAAATGTGG - Intronic
1080057394 11:27920277-27920299 GGTATAATTAGGATAAAATGAGG + Intergenic
1080675008 11:34417951-34417973 AGTGTTTTGAGGATTAAATGAGG + Intergenic
1080869842 11:36227602-36227624 GGTGCTAAGAGGATTAAATGAGG - Intronic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1081934527 11:46895763-46895785 GTTATTGTGAGGACGAAATGAGG + Intronic
1083150621 11:60789701-60789723 GTTGGAATGAGGACAAAATCAGG + Intronic
1084491890 11:69483436-69483458 GTTTTTATGAGGATAAAATGAGG + Intergenic
1085953540 11:81363109-81363131 GATGTTTTCAGGAAAAAATGAGG - Intergenic
1086747685 11:90450798-90450820 TGTCCTATGAGGACCAAATGTGG + Intergenic
1088280244 11:108127799-108127821 GCTGTTATGAGAATAAAATGAGG - Intronic
1088723968 11:112618370-112618392 AGTGTTAAGAGGAGAAAATGGGG - Intergenic
1089343941 11:117778172-117778194 GCTGTGATGAGGAGAAGATGTGG + Intronic
1089495249 11:118905037-118905059 GTTGGTATGAGGAGTAAATGAGG - Intronic
1089719340 11:120398484-120398506 GATTTTATGAGGAAAAGATGAGG - Intronic
1089988160 11:122832888-122832910 ATTGTTATGAGGATCAAATGAGG - Intergenic
1090800160 11:130165748-130165770 GCTGTTGTGAGGATAAAGTGAGG - Intronic
1093409693 12:18849690-18849712 TTTGTTATGAGGATTAAATGGGG + Intergenic
1093559882 12:20525238-20525260 TGTGTTGTGAGGACTGAATGAGG + Intronic
1094361702 12:29638206-29638228 GGTTTTATGGGCACAAGATGGGG - Intronic
1094388999 12:29928271-29928293 GCTGGTTTGAGAACAAAATGTGG + Intergenic
1095734267 12:45539252-45539274 GTTGTTATGAAGACAAAATAAGG + Intergenic
1095749282 12:45693498-45693520 GTTGTTGTGAGGATTAAATGGGG + Intergenic
1095773032 12:45983446-45983468 GGTATTTTGAGGATTAAATGTGG - Intronic
1097067131 12:56328870-56328892 GTCATTGTGAGGACAAAATGAGG - Intronic
1097152476 12:56989116-56989138 GTTGTTATGAGGATTAAATGAGG + Intergenic
1097243875 12:57595016-57595038 GGTTTTATGAGAATCAAATGAGG + Intronic
1097415183 12:59306341-59306363 GTTGTTTTGAGGATTAAATGAGG + Intergenic
1097900732 12:64871694-64871716 TTTGTTTTAAGGACAAAATGAGG - Intronic
1097932694 12:65207092-65207114 AGTGTTATGAGGATGAAATGAGG + Intronic
1098973006 12:76875813-76875835 GTTGTTATGAGGATTAAATGAGG - Intronic
1098973830 12:76881306-76881328 GTTGTTATGAGGATTAAATTGGG + Intergenic
1099543829 12:83950863-83950885 GTTTTTATGGGCACAAAATGGGG - Intergenic
1101140589 12:101791683-101791705 GCTGTGAGGAGGACAAAAGGAGG - Intronic
1101982723 12:109421635-109421657 GGTGTTATGAGAATATACTGGGG + Intronic
1102152082 12:110695786-110695808 GGCCTTATGAGGCCAAAAGGAGG + Intronic
1102836784 12:116070342-116070364 GTTGTTAGGAGGATTAAATGAGG + Intronic
1103812889 12:123629970-123629992 GTTGTTGTGAGGATTAAATGAGG - Intronic
1104202748 12:126607621-126607643 GGTGTGATAAAGACTAAATGAGG + Intergenic
1104257940 12:127156148-127156170 GCTGTTATGTGGACAGAAAGAGG + Intergenic
1104664381 12:130637179-130637201 GGTGATCTGAGGACAGGATGAGG - Intronic
1106017469 13:25883447-25883469 TGTGTTATGATTACAAACTGGGG + Intronic
1106729932 13:32530629-32530651 GCTTTTATGAGGATTAAATGAGG - Intronic
1106878150 13:34098639-34098661 GGTTTTATGTGGACAAAGTGTGG + Intergenic
1106942263 13:34792084-34792106 GGTTTTATGGGTACAAGATGGGG - Intergenic
1107184275 13:37498906-37498928 GGTTATAAGAGGACAACATGAGG - Intergenic
1107375086 13:39795717-39795739 GTTGTTGTGAGGATTAAATGAGG - Intergenic
1107715825 13:43198582-43198604 GTTGTTATGAGGATTAAATGAGG + Intergenic
1108934861 13:55871255-55871277 GCTTTTATGAGCTCAAAATGGGG + Intergenic
1109098845 13:58152573-58152595 GGTGTTATGAGAAAGAAATGAGG + Intergenic
1110071360 13:71182780-71182802 GATTTTATGAGTACAAGATGGGG + Intergenic
1110802294 13:79712990-79713012 GGTTGTATCAGGACAAAATCTGG + Intergenic
1110805666 13:79751491-79751513 GGTCTTAAGAGGAAGAAATGGGG - Intergenic
1111660842 13:91208751-91208773 GTTTTTATGAGGACTAAATGAGG - Intergenic
1113954551 13:114090363-114090385 TGTTTTATGATGGCAAAATGGGG + Intronic
1116825970 14:49673822-49673844 AGTATTATGAGGATTAAATGAGG + Intronic
1116888893 14:50248471-50248493 GTTGTTTTGAGGATTAAATGAGG - Intronic
1117068963 14:52039258-52039280 GCTGTTGTGAGGAATAAATGAGG - Intronic
1117455989 14:55897453-55897475 GGAATTATGAGGATCAAATGAGG - Intergenic
1117938284 14:60933095-60933117 GTTGTTTTGAGTACTAAATGAGG + Intronic
1117983599 14:61365718-61365740 GGTGGTATGAGGACATAAAGAGG + Intronic
1118126631 14:62912145-62912167 GTTGTTATGAGGATTACATGAGG + Intronic
1118433495 14:65747060-65747082 GTTGTTCTAAGGACATAATGTGG + Intergenic
1118487150 14:66224881-66224903 GGTTTTATGAGCACAAGATGGGG - Intergenic
1118502564 14:66376091-66376113 GTTGTTTTGAGGATTAAATGAGG - Intergenic
1118819199 14:69334094-69334116 GTTGTTATGAGTACTAAATGAGG + Intronic
1119640096 14:76308453-76308475 GGTTTTATGATGAGAAAGTGAGG + Intergenic
1119751959 14:77085089-77085111 GTGGTTATGAGGATGAAATGAGG + Intergenic
1119885169 14:78134331-78134353 GATGTTATGAGGACAGTATCTGG + Intergenic
1120128657 14:80778871-80778893 GTTGTTACGAGGATGAAATGAGG - Intronic
1120711229 14:87795281-87795303 GTTGTGATGAGGACTAAATGTGG + Intergenic
1121360592 14:93254736-93254758 GGTGGTGTGAGGATTAAATGAGG + Intronic
1121553072 14:94816889-94816911 GCTGTTAGGAGGAGAAAATGAGG - Intergenic
1121563432 14:94891602-94891624 GACGTTATGAGAACAACATGCGG - Intergenic
1122388244 14:101363247-101363269 GGTGTTGGGAGGAGAAAACGTGG - Intergenic
1122712200 14:103667077-103667099 AGTGTTATGAGAATTAAATGAGG - Intronic
1125541983 15:40474918-40474940 GCTGTTGTGAGGATTAAATGGGG - Intergenic
1126535836 15:49763195-49763217 GGTGTTAAGACTACAAAATGGGG - Intergenic
1127581026 15:60339659-60339681 GTTGTTGTGAGGATTAAATGAGG - Intergenic
1127973829 15:63982845-63982867 GTTGTTATGAGGATTAAATAAGG + Intronic
1129797860 15:78391731-78391753 GTTGTTGTGAGGACTAACTGAGG + Intergenic
1130523142 15:84679779-84679801 GTTGTTCTGAGGTTAAAATGTGG + Intronic
1130713520 15:86308686-86308708 GGTGTCAAGAGTACACAATGGGG - Intronic
1131472594 15:92709754-92709776 GGTGTTCAGAGGAAAGAATGTGG + Intronic
1131529865 15:93181857-93181879 GCTGTCAGGAGGACAAAATGAGG + Intergenic
1134130893 16:11649379-11649401 CATGTTATGAGGATTAAATGAGG - Intergenic
1134430024 16:14194844-14194866 GTTGTTATGAGGATTAGATGTGG + Intronic
1134909498 16:18011731-18011753 GGTTTTAAAAGGACAACATGAGG - Intergenic
1135191870 16:20361001-20361023 GTTGTTATAAGGATTAAATGAGG + Intronic
1135469134 16:22713449-22713471 GGTGTACTGGGGACATAATGGGG - Intergenic
1135731852 16:24901237-24901259 GTTGTTTTGAGGATGAAATGAGG - Intronic
1135792898 16:25414254-25414276 GTTGTTATGAGGAGAAAATGAGG + Intergenic
1135881426 16:26261445-26261467 GTTGTAGTGAGGACTAAATGAGG + Intergenic
1137410848 16:48227001-48227023 GGTAATATGAGGACAAAAGGTGG - Intronic
1137485926 16:48891057-48891079 GGTGTTTTAAGGACTAAAGGAGG - Intergenic
1137761172 16:50941518-50941540 GCTGTTACGAGCACAAAATGAGG - Intergenic
1137888836 16:52136579-52136601 TTTGTTATGAAGACCAAATGAGG + Intergenic
1138224156 16:55278182-55278204 GTCTTTTTGAGGACAAAATGGGG + Intergenic
1138438253 16:57018707-57018729 GGAGTTGTGAGGATAAAATAAGG + Intronic
1138461167 16:57148634-57148656 GGTGTTATGTGGAATAAAGGAGG - Intergenic
1138554567 16:57764024-57764046 TGGGTTGTGAGGACCAAATGAGG + Intronic
1138786272 16:59850358-59850380 GGTGTTAGGAAGATAAAATGAGG + Intergenic
1139936673 16:70576612-70576634 GCTGTTATGAGGACACACTGGGG + Exonic
1139983907 16:70882187-70882209 GTTGTTGTGAGGGCAAAAGGAGG + Intronic
1140293069 16:73682159-73682181 GCTCTTATGAGGATAAAATAAGG + Intergenic
1140704916 16:77618822-77618844 ACTATTATGAGGATAAAATGTGG + Intergenic
1140912372 16:79465802-79465824 GGTATTGTGAGGAATAAATGGGG + Intergenic
1141180356 16:81748789-81748811 GTTGTAATGAGGATAAGATGTGG - Intronic
1141804335 16:86332744-86332766 GTTGTTGTGAGGATTAAATGAGG + Intergenic
1141812371 16:86384029-86384051 GGTGTGATGAGTAAAGAATGAGG + Intergenic
1142644256 17:1301810-1301832 AGTGTTGTGAGGATTAAATGAGG - Intergenic
1145855152 17:28148661-28148683 GTTGTTATGAGGATTAAATGAGG + Intronic
1146002080 17:29137055-29137077 GTTGTTATGAGGATTCAATGAGG - Intronic
1146182232 17:30705842-30705864 GGTGCTAGGCGTACAAAATGTGG + Intergenic
1147135339 17:38430939-38430961 GGTATTGTGAGGATCAAATGAGG - Intronic
1149300746 17:55302975-55302997 GTTGTTAGGAGGGCAGAATGAGG + Intronic
1151250637 17:72831429-72831451 GGTGATTTGAGGATAAAATAAGG - Intronic
1151892159 17:76957174-76957196 GGTGTTTTGAGGACTAAAGGAGG + Intergenic
1152746291 17:82041144-82041166 GGTGTTCTGAGCTCAGAATGGGG + Intergenic
1152943732 17:83186845-83186867 GCTGCTGTGAGGACAAAATGAGG - Intergenic
1153443151 18:5143334-5143356 GTTGTTGGGAGGACAAAAGGAGG - Intergenic
1153676128 18:7457295-7457317 GGTGTTATTAGGCCTAAGTGGGG - Intergenic
1154229094 18:12538302-12538324 GGGGTTAGGGGGACAAAATTAGG + Intronic
1155010215 18:21769900-21769922 TGTGTTTTAAGAACAAAATGAGG + Intronic
1157152775 18:45234882-45234904 GATGTTGTGAGGACTAAATAAGG - Intronic
1157409480 18:47451788-47451810 GTTGTTGTGAGGACCAAAAGAGG + Intergenic
1158132901 18:54172880-54172902 AGGGTTATGGGAACAAAATGAGG + Intronic
1158767577 18:60473424-60473446 GGTTTTATGAGCAAAAACTGAGG + Intergenic
1158887984 18:61847004-61847026 ATTGTTATGAGGATTAAATGGGG + Intronic
1162976600 19:14209960-14209982 GGTGCTAGGCGTACAAAATGTGG - Intergenic
1163193667 19:15698035-15698057 GTTGTCCTGAGGACAAAATGTGG + Intergenic
1164288902 19:23849548-23849570 GGTGTTCTGGGCACAGAATGGGG + Intergenic
1164567929 19:29341645-29341667 AGTTTTATAAGGACAAACTGAGG + Intergenic
1165390536 19:35536179-35536201 GTTGTTGTGAGGATTAAATGAGG - Intronic
1165499964 19:36181068-36181090 ACTTTTATGAGGACTAAATGAGG - Intergenic
1168322887 19:55520891-55520913 GGGGTTGTGAGGATTAAATGTGG + Intergenic
925290835 2:2747805-2747827 GGTATTATGAGGAATAAATTAGG + Intergenic
926047722 2:9722225-9722247 AGGGTTAAAAGGACAAAATGAGG + Intergenic
926455765 2:13067320-13067342 GGTGTAATGAGGACAAAGATGGG + Intergenic
926489641 2:13507954-13507976 AGTGTCCTGAGAACAAAATGTGG + Intergenic
926555140 2:14348765-14348787 GGTGTTAAAAAGCCAAAATGTGG + Intergenic
926694019 2:15758129-15758151 GGTGTCATGAGGATGAAGTGAGG + Intergenic
926950207 2:18234641-18234663 GGTGGTAATAGGTCAAAATGTGG - Intronic
927285998 2:21357369-21357391 GCTGTTGTGAGGATTAAATGAGG - Intergenic
927307102 2:21586213-21586235 GGTGTTAGGAGGAAAAATTATGG - Intergenic
927343350 2:22007978-22008000 GATGGTAGGAAGACAAAATGTGG + Intergenic
927570932 2:24159149-24159171 GATGTTATCAGGTTAAAATGAGG - Intronic
928389098 2:30895396-30895418 GGTGCTATGGGGACACAAAGGGG + Intergenic
930053212 2:47233019-47233041 GTTGTTATGAAGACCAAATGAGG + Intergenic
930209974 2:48626135-48626157 GGTGCTAAGAGGACACAATGGGG - Intronic
930258299 2:49116521-49116543 GCTGTTGTGAGGATTAAATGAGG + Intronic
930292309 2:49510508-49510530 CCTGTTATGAGGACCAGATGAGG - Intergenic
930675542 2:54196972-54196994 TGTGCTATGAGGATTAAATGAGG - Intronic
930901932 2:56517730-56517752 GGTGTTATGAGAATAAAATGAGG - Intergenic
931909614 2:66884346-66884368 GGTGCTAAGAATACAAAATGGGG - Intergenic
932008723 2:67954165-67954187 GATGTTGTGAGGATAAAGTGAGG - Intergenic
932095690 2:68846363-68846385 GTTGTCATGAGGATTAAATGAGG + Intergenic
932121906 2:69109153-69109175 GTTGTTATGAGGTTTAAATGTGG + Intronic
932599552 2:73113863-73113885 GTTGCTCTGAGGATAAAATGAGG - Intronic
933298429 2:80516475-80516497 GGTGCTTTGAGGACCAGATGGGG - Intronic
933729059 2:85443663-85443685 GGTGTTCTGAGGACCAGATTTGG - Intergenic
934125373 2:88883419-88883441 GGTGTAAAGAGCACAAAATTAGG + Intergenic
934580346 2:95432847-95432869 GGAGCAATGAGGACAAACTGAGG - Intergenic
934599101 2:95643870-95643892 GGAGCAATGAGGACAAACTGAGG + Intergenic
935710580 2:105894719-105894741 GCTGTGATGAGGAACAAATGGGG - Intergenic
936171418 2:110180080-110180102 GTTGTTATGAGGCTTAAATGAGG - Intronic
936257294 2:110927709-110927731 GGTGTGATGATGCCAAATTGAGG - Intronic
936274636 2:111083859-111083881 ATTATTATGAGGACTAAATGAGG + Intronic
936374766 2:111930941-111930963 GTTGTTAAAAGCACAAAATGAGG + Intronic
936668809 2:114631409-114631431 GGAGTTAACAGGAGAAAATGAGG + Intronic
936911563 2:117598952-117598974 GGTGATATGAGAGTAAAATGTGG - Intergenic
937427483 2:121812238-121812260 GGTGTTGTGAGGAGAAACTCAGG + Intergenic
937449289 2:121988062-121988084 GGTGCCAAGAGGACACAATGGGG + Intergenic
937687298 2:124712302-124712324 GTTGTTGTGAGGATTAAATGAGG - Intronic
938785886 2:134629105-134629127 GGTTTTGTGAGGATCAAATGAGG - Intronic
939238087 2:139523352-139523374 GTTGTTATGAGGATTAAATAAGG + Intergenic
942665947 2:178318034-178318056 AGTGTTATGAGTACAGAATAAGG + Intronic
943168169 2:184359709-184359731 GATGTTTTGAAGAAAAAATGAGG - Intergenic
943634029 2:190285642-190285664 GGTAGTATGAGGCCAAAAGGTGG - Intronic
943752484 2:191524433-191524455 GTTGTTGTGAGGATAAAATAAGG - Intergenic
943842076 2:192596263-192596285 AATGTTATGAGGATTAAATGAGG - Intergenic
945628803 2:212244915-212244937 GTTGTTGTGAGGATTAAATGAGG - Intronic
945691497 2:213042225-213042247 GGTGTGATGAGCACAAATTGTGG + Intronic
946191182 2:218008953-218008975 AGTGTTGTGAGGATTAAATGAGG - Intergenic
946470854 2:219959640-219959662 GATGCTTTGAAGACAAAATGGGG + Intergenic
948005135 2:234602169-234602191 GATGTTGTCAGGACAAAATATGG + Intergenic
1169041428 20:2498715-2498737 GGAGTTGTGAGGAAGAAATGTGG - Intronic
1169368792 20:5012405-5012427 GTTGGTATGAGGATTAAATGAGG + Intergenic
1169920307 20:10727827-10727849 GGTGTTGTGAAAACAGAATGGGG - Intergenic
1170139268 20:13109478-13109500 GTTCTTATGAGGATTAAATGAGG + Intronic
1170877194 20:20261518-20261540 GCAGTTATGAGGAGAAAAAGGGG - Intronic
1172945821 20:38688409-38688431 GCTGTTGTAAGGACTAAATGAGG + Intergenic
1173372578 20:42451006-42451028 GAAGTTATCAGGGCAAAATGGGG + Intronic
1173426652 20:42948998-42949020 AGTGGGATGAGGACAACATGGGG - Intronic
1173666852 20:44769228-44769250 TGTGTTATGAGGAAGAAACGAGG - Intronic
1173745717 20:45435440-45435462 GGTGTTATGAAGATAAAAAGAGG + Intergenic
1173770226 20:45649939-45649961 GGTCATATGATGAGAAAATGGGG - Intronic
1173917007 20:46715138-46715160 GTTGTTATGAGGATGAATTGAGG + Intronic
1174349935 20:49959796-49959818 GTTGTTTAAAGGACAAAATGAGG - Intergenic
1174587149 20:51618239-51618261 GGTGTCATGAAGACTAAAAGGGG - Intronic
1174908191 20:54574736-54574758 GGGCTTAGGAGGACAAATTGGGG + Intronic
1174925798 20:54758344-54758366 CGTTATATGAGGATAAAATGTGG - Intergenic
1175781927 20:61688334-61688356 GGTGGGAGGAGGACACAATGGGG - Intronic
1178269531 21:31177180-31177202 GCTGTTGTGAGGACCAAATGAGG - Intronic
1179186826 21:39091238-39091260 GCTGTGAGGAAGACAAAATGAGG + Intergenic
1180733258 22:17997782-17997804 GTTGTTGTGAGGAATAAATGAGG + Intronic
1181981468 22:26769728-26769750 GTTGTTAGGAGGACAAAATGAGG + Intergenic
1183172466 22:36198388-36198410 TGTGTTATGATGAAAAACTGTGG - Intronic
1183804527 22:40196895-40196917 GTTGTTGGGAGGACTAAATGAGG - Intronic
1184321868 22:43748053-43748075 GGTGTTGTGGGGACACCATGTGG - Intronic
949460023 3:4281429-4281451 ATTGTTATGAGGACTAAATGAGG - Intronic
949899277 3:8796299-8796321 GTTGTTATGAGGGACAAATGAGG - Intronic
949960124 3:9304962-9304984 GTTGTTGTGAGGATTAAATGAGG - Intronic
950152743 3:10700564-10700586 GGTATTACGAACACAAAATGGGG - Intronic
950195050 3:11003381-11003403 GCTGCTATGAGGATTAAATGGGG - Intronic
950283561 3:11727106-11727128 ATTGTTATGAGGCCAAAATTCGG - Intergenic
950669770 3:14519049-14519071 GGTGTCATGAGGAAGTAATGAGG + Intronic
950909666 3:16575873-16575895 GGTGTTGTAAGGATTAAATGGGG + Intergenic
951633789 3:24750638-24750660 GGTGGTTTGAGGATTAAATGAGG + Intergenic
952061754 3:29519266-29519288 GGAATTATGAGGACTAAATAAGG + Intronic
952830337 3:37559411-37559433 GTTGGTGTGAGGATAAAATGAGG + Intronic
952840390 3:37640954-37640976 GGTGTTGTGAGGAGAGGATGAGG + Intronic
952981430 3:38739134-38739156 GTTGTTGTGAGCATAAAATGAGG + Intronic
953234037 3:41090458-41090480 GGAGTTATGAGGATTTAATGAGG + Intergenic
953689730 3:45107602-45107624 GGTGTTGTGAGGACAGTGTGAGG - Intronic
953848018 3:46444274-46444296 GCTGGTATGAAGACAATATGGGG - Intronic
953873286 3:46646464-46646486 GGTGTGATGAGGCCGAGATGAGG + Intergenic
954757906 3:52851984-52852006 GCTGCTATGAGGACAAAGGGAGG + Intronic
955057741 3:55471506-55471528 GCTGTTATAAGGATAAAATTAGG + Intronic
955245021 3:57217157-57217179 GGTGTTTAGAGGGCAAAATCTGG + Intronic
955320420 3:57970366-57970388 GCTGTTTTGAGGATTAAATGAGG + Intergenic
955406662 3:58630069-58630091 GGGGCTATGAGGATGAAATGAGG + Intergenic
955904087 3:63788669-63788691 GCTGTTATGAGGATTAAATGAGG - Intergenic
956755934 3:72386582-72386604 GATGAAATGAGGACAAAATTAGG + Intronic
956951147 3:74284484-74284506 GTAGTTATGAGGATTAAATGTGG + Intronic
958023927 3:88028246-88028268 GGTTTTATGAGTACAAGATGGGG - Intergenic
958982186 3:100734929-100734951 GGTGTGATGTGGTAAAAATGTGG + Intronic
959487143 3:106940022-106940044 GGTGTTATGAGTATATAATTTGG - Intergenic
959696673 3:109255745-109255767 GCTGTTATGAGGATAAAAATTGG - Intergenic
960609036 3:119538079-119538101 GTTTCTGTGAGGACAAAATGAGG - Intronic
960680837 3:120246042-120246064 ACTGTAGTGAGGACAAAATGAGG - Intronic
961413534 3:126741043-126741065 GTTGTGGTGAGGACCAAATGAGG + Intronic
962118822 3:132540892-132540914 GGTGTTATGAGAATTAAATAGGG + Intergenic
962221494 3:133568060-133568082 GGAGTTGTGAGGATGAAATGTGG - Intergenic
962569027 3:136693410-136693432 GGGGTTCTGAGGACACATTGGGG - Intronic
962623832 3:137205118-137205140 GTTGCTGTGAGGACTAAATGAGG + Intergenic
962625992 3:137226740-137226762 ACTGTTAAGAGGACAAAATGGGG - Intergenic
964254491 3:154760918-154760940 GTTATTATGAGGAATAAATGAGG + Intergenic
964468351 3:157023602-157023624 GCTGTTATGAGGATTAAAGGAGG - Intronic
965711353 3:171559345-171559367 AGTGTTGTGAGGAATAAATGTGG + Intergenic
965952052 3:174321291-174321313 GGGGCTATGAACACAAAATGGGG + Intergenic
966238043 3:177724713-177724735 GTTGTTATAAGGACACAAGGAGG - Intergenic
967019819 3:185512910-185512932 GGTGTTAAGAAAACAAAATCTGG - Intronic
967190839 3:186983691-186983713 TTTATTATGAGGAAAAAATGAGG - Intronic
967422690 3:189291310-189291332 GGGGATATGAGGACCAAATGAGG + Intronic
967460041 3:189734981-189735003 AGTGTTTTGAGGAGTAAATGGGG - Intronic
969961511 4:10949036-10949058 GGTGTTAAGAGCAGAAACTGAGG + Intergenic
970039417 4:11779142-11779164 GTTTTTCTGAGGACTAAATGGGG + Intergenic
970422645 4:15919705-15919727 GATGTTTTGAGGAATAAATGAGG - Intergenic
971901234 4:32660798-32660820 TGAGTTAGGTGGACAAAATGGGG + Intergenic
972205246 4:36763935-36763957 AGTATTTTGAGGAAAAAATGTGG - Intergenic
973167542 4:47096134-47096156 AGTGGTATGAGCACAAAAGGAGG - Intronic
973725571 4:53772339-53772361 GGTGTCTTGAGGATAATATGAGG - Intronic
974067063 4:57088421-57088443 GGTATTATATGGAGAAAATGAGG - Intronic
974345874 4:60680249-60680271 GGTGTCATGTGGACAGACTGGGG - Intergenic
974617191 4:64305539-64305561 GGAGTTAGCAGGACAAAATATGG + Intronic
974764945 4:66331883-66331905 GATGTTATGAGCACCACATGTGG + Intergenic
975847984 4:78545488-78545510 GTTGTTATGAAGACTGAATGAGG - Intergenic
976533061 4:86178246-86178268 GGTATTATAAAGATAAAATGAGG + Intronic
976674164 4:87685858-87685880 AGTGTTATGGGAAAAAAATGGGG - Intergenic
976976576 4:91172606-91172628 GGTGGTGTGATGACAAAATGAGG - Intronic
977292985 4:95183160-95183182 GCTGTTGTGAGGATTAAATGAGG - Intronic
977804026 4:101275096-101275118 AGGGTTATGAGGAAATAATGAGG - Intronic
979952213 4:126907332-126907354 GATGTTCTCAGCACAAAATGTGG - Intergenic
980849880 4:138368053-138368075 GTTGTTATGAGGAAAAACTAGGG + Intergenic
981535674 4:145796929-145796951 GTTGTTAGGAGGAACAAATGAGG - Intronic
981849540 4:149213277-149213299 GGTCTTGTGAGGAAAAAAAGTGG - Intergenic
982582564 4:157197497-157197519 GTTGTCATGAAGATAAAATGAGG + Intergenic
982633101 4:157857267-157857289 GTTGTTATGGGGAAAAAAAGTGG - Intergenic
982694242 4:158581655-158581677 GTTGTCATGAGGATTAAATGAGG - Intronic
982888582 4:160818048-160818070 ACTGTCATGAGAACAAAATGTGG - Intergenic
983956853 4:173708233-173708255 GGGGTTGTGAGGAAAAAATGGGG - Intergenic
984292097 4:177808394-177808416 GTTTTTATGGGGACAGAATGGGG + Intronic
985269871 4:188183842-188183864 GGTTTTATGAGTACAGGATGCGG - Intergenic
986208492 5:5648281-5648303 GGTATTAAGAGCACAAACTGTGG + Intergenic
986243802 5:5986439-5986461 GGTGTTTAGAAGCCAAAATGAGG + Intergenic
986339223 5:6775285-6775307 GATTTTTTAAGGACAAAATGAGG + Intergenic
986857485 5:11887739-11887761 GGAGACATGAGGACTAAATGTGG - Intronic
987570018 5:19645172-19645194 GGTTTTATGAAGACAAAAAATGG + Intronic
987662660 5:20896881-20896903 GGGGTTATGTAGACAAAATTTGG - Intergenic
988443991 5:31264384-31264406 GGTGTTATAAGGATTAAATGAGG - Intronic
988760922 5:34308433-34308455 GGGGTTATGCAGACAAAATTTGG + Intergenic
988819295 5:34864724-34864746 GCTGTTGTGAGGATTAAATGGGG - Intronic
989114776 5:37941973-37941995 GTTGTCATGAGGATTAAATGTGG - Intergenic
990484918 5:56248755-56248777 GTTGTTGTGAGGATAAACTGGGG + Intergenic
992833434 5:80617611-80617633 TGAGTTTTGAGGACAGAATGTGG + Intergenic
993421904 5:87713566-87713588 GATTTTATGAGCACAAAAGGTGG - Intergenic
993454584 5:88112978-88113000 GGTGTCATGAGTACAAAATAAGG + Intergenic
993881359 5:93365669-93365691 GCTGTTGTGAGGATTAAATGCGG - Intergenic
994898807 5:105744246-105744268 GGTTTTATGGGCACAAAATGGGG - Intergenic
995791281 5:115891004-115891026 CCTGTTATGAGGACTGAATGGGG - Intronic
996637818 5:125716038-125716060 GGTGCTTTGAGGATTAAATGTGG + Intergenic
996975880 5:129434099-129434121 GGTGATATGAGGCCAGAATGAGG - Intergenic
997532708 5:134592059-134592081 GGTATGAAGTGGACAAAATGAGG + Intergenic
997581615 5:135020714-135020736 GGTTTTATGAGTGGAAAATGCGG - Intergenic
998504945 5:142664911-142664933 GTTATTTTGAGGATAAAATGAGG + Intronic
998661201 5:144240021-144240043 GCTGCTATGAGGACTAAAGGGGG - Intronic
998671186 5:144356104-144356126 GGTGTTATAAGAACAAAACATGG - Intronic
999537040 5:152528892-152528914 GTTTTTATGGGCACAAAATGGGG + Intergenic
1000504552 5:162098942-162098964 GTTGCTATAAGGACAAAATAGGG + Intronic
1000619017 5:163461417-163461439 GGTGTTAAGAGCACACGATGGGG - Intronic
1001757093 5:174178994-174179016 GTTGTTGTGAGGACTAAATAAGG - Intronic
1002949421 6:1794566-1794588 TGTGTTATGAAGTCAAACTGAGG - Intronic
1003064461 6:2891448-2891470 GTTATGATGAGGATAAAATGTGG - Intronic
1003298250 6:4853264-4853286 GTTGTTATGAGAACTGAATGTGG - Intronic
1003467466 6:6394508-6394530 GATGTTAAGAGGTCAAGATGTGG - Intergenic
1004183797 6:13404570-13404592 GGTGTTACAAGAACTAAATGAGG + Intronic
1004594112 6:17082669-17082691 GATGTTCTGATGACAAGATGTGG - Intergenic
1005130129 6:22497187-22497209 GTACTTATGAGAACAAAATGGGG - Intergenic
1005399448 6:25416474-25416496 GGTGCTGTGAGGATTAAATGTGG + Intronic
1006732333 6:36245708-36245730 GCTGTTGTGAGGACTGAATGAGG - Intronic
1008423953 6:51334722-51334744 GTTGTTATGAAGATTAAATGAGG + Intergenic
1008946239 6:57100008-57100030 GTTGTTGTGAGGATGAAATGAGG + Intronic
1009634284 6:66244477-66244499 GGTTTCATGAGGAAAAAAAGTGG - Intergenic
1010492102 6:76488976-76488998 GGTGTTCTGGGCTCAAAATGGGG + Intergenic
1011007053 6:82657328-82657350 GCTGGAGTGAGGACAAAATGTGG - Intergenic
1011220615 6:85051103-85051125 GGTGTGATGAGAAGAAAAAGAGG + Intergenic
1011792265 6:90911225-90911247 GGTGTTTTGAGGATTCAATGAGG + Intergenic
1013054484 6:106570119-106570141 TGAGTGATGAGGACAAAAAGAGG - Exonic
1013219589 6:108066377-108066399 GTTGTTATGAGGATTAAATAAGG - Intronic
1013299881 6:108794992-108795014 GGTGCTTTGGGGACAAAAGGAGG + Intergenic
1013337403 6:109177680-109177702 AATGTGTTGAGGACAAAATGGGG + Intergenic
1013609393 6:111779878-111779900 GTTGTTGTGAGAATAAAATGAGG - Intronic
1013747930 6:113367695-113367717 GGAGTTCTGAGGATCAAATGAGG - Intergenic
1014089921 6:117392558-117392580 GTTATTTTGAAGACAAAATGAGG - Intronic
1014263414 6:119247394-119247416 GTTGTTGTGAGGATAATATGTGG + Intronic
1014273898 6:119365346-119365368 GGTCATATGAGGACACAATAGGG - Intergenic
1014863380 6:126497619-126497641 GGTGGCAGGAGGATAAAATGAGG + Intergenic
1015112423 6:129608866-129608888 TGTGTTAGGAAGAGAAAATGTGG - Intronic
1015120376 6:129694402-129694424 GTTGCTATGAGGATTAAATGAGG + Intronic
1015776280 6:136817824-136817846 GTTGTTGTGAGGATTAAATGGGG - Intergenic
1016922735 6:149312221-149312243 GCTCTTATGTGCACAAAATGTGG - Intronic
1017746341 6:157449996-157450018 GTTGTTCTGAGGACTAAAGGAGG + Intronic
1019015509 6:168877080-168877102 GGTGTGATGAGCACAGCATGAGG + Intergenic
1020737015 7:11963595-11963617 GGTTTTATGAGGAAAAACAGAGG + Intergenic
1020824007 7:13004334-13004356 GGTGTTAACAGTACACAATGAGG - Intergenic
1022180166 7:27911326-27911348 GCTGTTATGAGGATTAAATAAGG - Intronic
1022613889 7:31908597-31908619 TGTGTTTTGTGGACTAAATGAGG - Intronic
1023305721 7:38824403-38824425 TTTGCTATGAGGACCAAATGAGG - Intronic
1024464927 7:49702170-49702192 ATTATTGTGAGGACAAAATGAGG + Intergenic
1024960194 7:54966469-54966491 GGTGTCATGAGGATTAAATGAGG - Intergenic
1024960238 7:54966943-54966965 GGTGTCATGAGGATTAAATGAGG + Intergenic
1025056130 7:55766762-55766784 GCTGTTATGAGGATTAAATGAGG - Intergenic
1025084765 7:56014167-56014189 GCTGTTATGAAGATTAAATGAGG + Intronic
1028585268 7:92446236-92446258 GTTGTTATAAGCACTAAATGTGG + Intergenic
1028965951 7:96801426-96801448 TGTGTTGTGAGGATTAAATGAGG - Intergenic
1031024863 7:116669336-116669358 GTTATTGTGAGGATAAAATGAGG - Intergenic
1031342174 7:120616313-120616335 GCTGTTATGAGGATTAAATGAGG + Intronic
1032056286 7:128687114-128687136 AGTGTCATGAGGGCAATATGTGG - Intergenic
1032436395 7:131904478-131904500 GGTGTCATGAGGGGAAACTGGGG - Intergenic
1032598218 7:133263951-133263973 GGTGTTATGTGGTCAAATTTTGG - Intronic
1033069111 7:138185797-138185819 GATGTGATGAAGATAAAATGAGG - Intergenic
1034021620 7:147650327-147650349 GGTGCTATGAGAATACAATGAGG + Intronic
1034187138 7:149187059-149187081 GGTGTTGTGAAGATCAAATGAGG + Intergenic
1034362379 7:150511646-150511668 AGTGTTATGGGGATAAAATCAGG - Intergenic
1034827954 7:154284004-154284026 GATGTCATGAGGCCAACATGAGG - Intronic
1035124905 7:156601517-156601539 GCGGTTATGAGTACGAAATGAGG - Intergenic
1036688955 8:10929262-10929284 GGTGTTGTGAGGATTAAATGAGG - Intronic
1036979451 8:13453017-13453039 GGTTTTGTGAGGAAAAAGTGAGG - Intronic
1037403844 8:18521205-18521227 GTTGTTATGAGGCTTAAATGAGG - Intergenic
1038697138 8:29816687-29816709 GTTGTTGTGAGGATTAAATGAGG + Intergenic
1039591283 8:38751966-38751988 GGTGCTATGAGGCCCGAATGTGG + Intronic
1040584791 8:48728618-48728640 GTTATTATGAGGATTAAATGAGG + Intronic
1040652701 8:49466555-49466577 GGGATTAGCAGGACAAAATGAGG + Intergenic
1041454545 8:58043767-58043789 GCTGTTAGGAGGATTAAATGAGG - Intronic
1042481418 8:69307893-69307915 GTTGTTGTGAGGACTGAATGAGG - Intergenic
1042639848 8:70921823-70921845 GGTGTTAAGAAAACAAAATTTGG - Intergenic
1042650126 8:71031531-71031553 ACTGTTATGAGAACTAAATGAGG + Intergenic
1042703730 8:71644531-71644553 GCTGGTATGAGGATTAAATGAGG + Intergenic
1043077473 8:75720112-75720134 GTTTTTATGGGCACAAAATGGGG - Intergenic
1043830578 8:84983973-84983995 GTTGTTATTAGGAAAAAATATGG - Intergenic
1044022482 8:87122822-87122844 GGTGCTGAGAGTACAAAATGGGG - Intronic
1044451927 8:92345985-92346007 GGGACTATGAGAACAAAATGTGG - Intergenic
1045082013 8:98636141-98636163 GTTGTTATGAGGATTGAATGAGG - Intronic
1045171286 8:99671889-99671911 GGTGTCAAGAACACAAAATGGGG - Intronic
1047691506 8:127359360-127359382 ATTGTTATGAGGCCAAAATAAGG + Intergenic
1047918835 8:129611926-129611948 GGAGCTATGAGGATTAAATGAGG - Intergenic
1047996566 8:130342345-130342367 GATGTTCTGAGGAGAAAATCTGG - Intronic
1048146071 8:131844948-131844970 GGTGGTATGGGGATCAAATGAGG + Intergenic
1048835672 8:138516692-138516714 CCTCTTATGAGGACAAATTGGGG + Intergenic
1049272370 8:141702752-141702774 GGTGTGAGGAGCACAAAGTGTGG - Intergenic
1049294271 8:141822460-141822482 GGTTTTATCAGGACAAAACCTGG - Intergenic
1050227057 9:3471258-3471280 GTTGTTCTGAGGACAAAGTTAGG - Intronic
1050243174 9:3659301-3659323 GGGGCTGTGAGGACAAAATTTGG - Intergenic
1051513154 9:17902552-17902574 GGTTTTGTGAGGACAAAGAGAGG + Intergenic
1051548105 9:18299077-18299099 GCTATTATGAGAACTAAATGAGG - Intergenic
1051936673 9:22450754-22450776 GGTGTTATGCAGACAATTTGGGG + Intronic
1051939398 9:22486961-22486983 GGTGTTAAGAGGTCAAAAGCGGG + Intergenic
1052380743 9:27768052-27768074 GTTGTTTTGAGGATGAAATGGGG + Intergenic
1052746154 9:32443167-32443189 GGTGTTATGAGGCAAAAATAAGG + Intronic
1054707026 9:68473172-68473194 GGAGTTATGAGGTTAAAGTGGGG - Intronic
1055142524 9:72892125-72892147 GTTGTTGAGAGGAGAAAATGAGG + Intergenic
1055154099 9:73039372-73039394 GGTGTTTTGAGGATAAACTCAGG - Intronic
1055325334 9:75122411-75122433 TGAGTTGTGAGGACCAAATGAGG + Intronic
1055760302 9:79599868-79599890 AGTGCTATGAAGACAAAATTGGG - Intronic
1055772054 9:79728015-79728037 GATGTTATTAGGACAATGTGTGG - Intergenic
1055794562 9:79961010-79961032 GGTGTTGTGAGGATGAAATGAGG + Intergenic
1055852617 9:80650421-80650443 GGTTTTATGCAGACTAAATGTGG + Intergenic
1059115508 9:111597623-111597645 GAAGTTATAAGGATAAAATGAGG - Intronic
1059539535 9:115117032-115117054 GTCGTTTTGAGGAGAAAATGAGG - Intronic
1059556146 9:115282399-115282421 GCTGTCATGAGAACAACATGGGG + Intronic
1060292685 9:122318861-122318883 ATTGATATGAGGACCAAATGAGG + Intronic
1060800286 9:126540203-126540225 TGTGTCATGAAGACAAAAGGAGG - Intergenic
1060910232 9:127343737-127343759 TGTGTTATGAGGTTTAAATGAGG - Intronic
1061302110 9:129711340-129711362 GTTGTTATGAGGGTTAAATGAGG + Intronic
1061653713 9:132071116-132071138 GGTGTTATGAGGACAAAATGAGG - Intronic
1186592986 X:10951005-10951027 GTTGTCATGAGCAGAAAATGAGG - Intergenic
1187622414 X:21072726-21072748 GGTGTTAAGAGTAAAAAATAAGG + Intergenic
1188013745 X:25085118-25085140 GTTGTTTTGAGAACAAAATGAGG + Intergenic
1188280104 X:28256708-28256730 GTTGTTATGAGGCAAAAAGGAGG - Intergenic
1189178059 X:38978083-38978105 GATGGCATGAGGACAAAATAAGG - Intergenic
1189251377 X:39602820-39602842 GGGGTTTTGAGGAGAGAATGAGG - Intergenic
1189321200 X:40088723-40088745 GATGTTATGAGGGCTCAATGTGG - Intronic
1189703103 X:43732254-43732276 GGTGTTGTGAGAATTAAATGAGG + Intronic
1190708440 X:53049017-53049039 TGTCTTCTGAGGACAAAAGGCGG + Intergenic
1191054844 X:56231414-56231436 GTTGTTATTGGGACTAAATGGGG + Intergenic
1192080189 X:68040281-68040303 GATATTATGAGGACAAAATAAGG + Intergenic
1192190555 X:68988822-68988844 GTGGTTCTGAGGACAAAATGAGG - Intergenic
1192382470 X:70632758-70632780 GGTGTTAAAAGGATAATATGGGG + Intronic
1192875425 X:75224572-75224594 GGTGTGATCAGGAAAAAACGTGG - Intergenic
1193041120 X:77004863-77004885 GGTGGTACCAGGTCAAAATGTGG - Intergenic
1193208750 X:78780339-78780361 GTTGTTGTGAGGATCAAATGAGG + Intergenic
1194190314 X:90827144-90827166 AGTGTAATCAGGAGAAAATGAGG - Intergenic
1194609710 X:96027236-96027258 GCTGTTAAGAGAACAAAATTAGG + Intergenic
1195238550 X:102927196-102927218 GGAGGCATGAAGACAAAATGAGG - Intergenic
1195338715 X:103883118-103883140 GGTATTGTGAGGACTAAGTGAGG + Intergenic
1195604081 X:106782656-106782678 GTTGTTGTGAGGATTAAATGAGG + Intronic
1196575283 X:117310237-117310259 GTTGTTGTGAGGATTAAATGAGG + Intergenic
1196871758 X:120119190-120119212 GGTGTTTTGAGGATTAATTGAGG - Intergenic
1196928828 X:120660968-120660990 GTTGTTATGAAGATTAAATGTGG - Intergenic
1197679890 X:129371145-129371167 GGTGCTATGAGGCCCAAAAGGGG + Intergenic
1198564347 X:137888633-137888655 GTTGTTGTGAGGATTAAATGAGG + Intergenic
1199005590 X:142692925-142692947 GGTGATATGAGGTTAAAGTGAGG - Intergenic
1199260121 X:145763002-145763024 GGTGTTAAGATCACATAATGAGG + Intergenic
1199963667 X:152800344-152800366 GGTTTTAAAAGGAAAAAATGAGG + Intergenic
1200320958 X:155189204-155189226 GTTGTTATGAGGGTTAAATGAGG + Intergenic
1200536969 Y:4409564-4409586 AGTGTAATCAGGAGAAAATGAGG - Intergenic
1202275764 Y:23118161-23118183 GGTGTTGTAAGGATTAAATGAGG + Intergenic
1202290264 Y:23302530-23302552 GGTGTTGTAAGGATTAAATGAGG - Intergenic
1202428758 Y:24751880-24751902 GGTGTTGTAAGGATTAAATGAGG + Intergenic
1202442033 Y:24918209-24918231 GGTGTTGTAAGGATTAAATGAGG - Intergenic