ID: 1061659354

View in Genome Browser
Species Human (GRCh38)
Location 9:132118380-132118402
Sequence CTGTTGTTATGAAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061659354_1061659359 4 Left 1061659354 9:132118380-132118402 CCATCTTCCCTTCATAACAACAG No data
Right 1061659359 9:132118407-132118429 ACGATTTACACCCACTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061659354 Original CRISPR CTGTTGTTATGAAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr