ID: 1061661534

View in Genome Browser
Species Human (GRCh38)
Location 9:132133439-132133461
Sequence GGTTGGGCATAGAACCAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061661528_1061661534 4 Left 1061661528 9:132133412-132133434 CCCTGAGATGGGGTTAAGGGAGA No data
Right 1061661534 9:132133439-132133461 GGTTGGGCATAGAACCAGAGCGG No data
1061661529_1061661534 3 Left 1061661529 9:132133413-132133435 CCTGAGATGGGGTTAAGGGAGAA No data
Right 1061661534 9:132133439-132133461 GGTTGGGCATAGAACCAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061661534 Original CRISPR GGTTGGGCATAGAACCAGAG CGG Intergenic
No off target data available for this crispr