ID: 1061661652

View in Genome Browser
Species Human (GRCh38)
Location 9:132134184-132134206
Sequence ACCTGAGCTCTTCCTCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061661650_1061661652 -8 Left 1061661650 9:132134169-132134191 CCATTGATGCCTATAACCTGAGC No data
Right 1061661652 9:132134184-132134206 ACCTGAGCTCTTCCTCTGAAAGG No data
1061661649_1061661652 -2 Left 1061661649 9:132134163-132134185 CCAGGGCCATTGATGCCTATAAC No data
Right 1061661652 9:132134184-132134206 ACCTGAGCTCTTCCTCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061661652 Original CRISPR ACCTGAGCTCTTCCTCTGAA AGG Intergenic
No off target data available for this crispr