ID: 1061664465

View in Genome Browser
Species Human (GRCh38)
Location 9:132152381-132152403
Sequence TTCCCCAGTGGCCGCGCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061664461_1061664465 -9 Left 1061664461 9:132152367-132152389 CCGCCGCCTCTGTGTTCCCCAGT No data
Right 1061664465 9:132152381-132152403 TTCCCCAGTGGCCGCGCCGCTGG No data
1061664455_1061664465 18 Left 1061664455 9:132152340-132152362 CCAGAAGCTCAGGCCTGTCTACC No data
Right 1061664465 9:132152381-132152403 TTCCCCAGTGGCCGCGCCGCTGG No data
1061664458_1061664465 -3 Left 1061664458 9:132152361-132152383 CCCGGCCCGCCGCCTCTGTGTTC No data
Right 1061664465 9:132152381-132152403 TTCCCCAGTGGCCGCGCCGCTGG No data
1061664459_1061664465 -4 Left 1061664459 9:132152362-132152384 CCGGCCCGCCGCCTCTGTGTTCC No data
Right 1061664465 9:132152381-132152403 TTCCCCAGTGGCCGCGCCGCTGG No data
1061664457_1061664465 5 Left 1061664457 9:132152353-132152375 CCTGTCTACCCGGCCCGCCGCCT No data
Right 1061664465 9:132152381-132152403 TTCCCCAGTGGCCGCGCCGCTGG No data
1061664460_1061664465 -8 Left 1061664460 9:132152366-132152388 CCCGCCGCCTCTGTGTTCCCCAG No data
Right 1061664465 9:132152381-132152403 TTCCCCAGTGGCCGCGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061664465 Original CRISPR TTCCCCAGTGGCCGCGCCGC TGG Intergenic