ID: 1061664993

View in Genome Browser
Species Human (GRCh38)
Location 9:132155450-132155472
Sequence GCTCCGTGTCAGAAGAGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061664993_1061665003 29 Left 1061664993 9:132155450-132155472 CCATTACTCTTCTGACACGGAGC No data
Right 1061665003 9:132155502-132155524 GAACAGAGAGCCTTGGCCAGAGG No data
1061664993_1061665002 22 Left 1061664993 9:132155450-132155472 CCATTACTCTTCTGACACGGAGC No data
Right 1061665002 9:132155495-132155517 CATCGTGGAACAGAGAGCCTTGG No data
1061664993_1061664994 -10 Left 1061664993 9:132155450-132155472 CCATTACTCTTCTGACACGGAGC No data
Right 1061664994 9:132155463-132155485 GACACGGAGCAATGTTCCCCTGG No data
1061664993_1061664997 7 Left 1061664993 9:132155450-132155472 CCATTACTCTTCTGACACGGAGC No data
Right 1061664997 9:132155480-132155502 CCCTGGACTCCCCATCATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061664993 Original CRISPR GCTCCGTGTCAGAAGAGTAA TGG (reversed) Intergenic
No off target data available for this crispr