ID: 1061664994

View in Genome Browser
Species Human (GRCh38)
Location 9:132155463-132155485
Sequence GACACGGAGCAATGTTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061664993_1061664994 -10 Left 1061664993 9:132155450-132155472 CCATTACTCTTCTGACACGGAGC No data
Right 1061664994 9:132155463-132155485 GACACGGAGCAATGTTCCCCTGG No data
1061664987_1061664994 28 Left 1061664987 9:132155412-132155434 CCAGGCTTGATGGCCAGGTGACA No data
Right 1061664994 9:132155463-132155485 GACACGGAGCAATGTTCCCCTGG No data
1061664989_1061664994 15 Left 1061664989 9:132155425-132155447 CCAGGTGACACTGGTTAGTCTAA No data
Right 1061664994 9:132155463-132155485 GACACGGAGCAATGTTCCCCTGG No data
1061664991_1061664994 -8 Left 1061664991 9:132155448-132155470 CCCCATTACTCTTCTGACACGGA No data
Right 1061664994 9:132155463-132155485 GACACGGAGCAATGTTCCCCTGG No data
1061664986_1061664994 29 Left 1061664986 9:132155411-132155433 CCCAGGCTTGATGGCCAGGTGAC No data
Right 1061664994 9:132155463-132155485 GACACGGAGCAATGTTCCCCTGG No data
1061664992_1061664994 -9 Left 1061664992 9:132155449-132155471 CCCATTACTCTTCTGACACGGAG No data
Right 1061664994 9:132155463-132155485 GACACGGAGCAATGTTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061664994 Original CRISPR GACACGGAGCAATGTTCCCC TGG Intergenic
No off target data available for this crispr