ID: 1061664997

View in Genome Browser
Species Human (GRCh38)
Location 9:132155480-132155502
Sequence CCCTGGACTCCCCATCATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061664992_1061664997 8 Left 1061664992 9:132155449-132155471 CCCATTACTCTTCTGACACGGAG No data
Right 1061664997 9:132155480-132155502 CCCTGGACTCCCCATCATCGTGG No data
1061664993_1061664997 7 Left 1061664993 9:132155450-132155472 CCATTACTCTTCTGACACGGAGC No data
Right 1061664997 9:132155480-132155502 CCCTGGACTCCCCATCATCGTGG No data
1061664991_1061664997 9 Left 1061664991 9:132155448-132155470 CCCCATTACTCTTCTGACACGGA No data
Right 1061664997 9:132155480-132155502 CCCTGGACTCCCCATCATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061664997 Original CRISPR CCCTGGACTCCCCATCATCG TGG Intergenic
No off target data available for this crispr