ID: 1061665002

View in Genome Browser
Species Human (GRCh38)
Location 9:132155495-132155517
Sequence CATCGTGGAACAGAGAGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061664995_1061665002 -7 Left 1061664995 9:132155479-132155501 CCCCTGGACTCCCCATCATCGTG No data
Right 1061665002 9:132155495-132155517 CATCGTGGAACAGAGAGCCTTGG No data
1061664992_1061665002 23 Left 1061664992 9:132155449-132155471 CCCATTACTCTTCTGACACGGAG No data
Right 1061665002 9:132155495-132155517 CATCGTGGAACAGAGAGCCTTGG No data
1061664991_1061665002 24 Left 1061664991 9:132155448-132155470 CCCCATTACTCTTCTGACACGGA No data
Right 1061665002 9:132155495-132155517 CATCGTGGAACAGAGAGCCTTGG No data
1061664996_1061665002 -8 Left 1061664996 9:132155480-132155502 CCCTGGACTCCCCATCATCGTGG No data
Right 1061665002 9:132155495-132155517 CATCGTGGAACAGAGAGCCTTGG No data
1061664993_1061665002 22 Left 1061664993 9:132155450-132155472 CCATTACTCTTCTGACACGGAGC No data
Right 1061665002 9:132155495-132155517 CATCGTGGAACAGAGAGCCTTGG No data
1061664998_1061665002 -9 Left 1061664998 9:132155481-132155503 CCTGGACTCCCCATCATCGTGGA No data
Right 1061665002 9:132155495-132155517 CATCGTGGAACAGAGAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061665002 Original CRISPR CATCGTGGAACAGAGAGCCT TGG Intergenic
No off target data available for this crispr