ID: 1061667015

View in Genome Browser
Species Human (GRCh38)
Location 9:132166467-132166489
Sequence GGGATAAGGAGAAAATCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061667015 Original CRISPR GGGATAAGGAGAAAATCCGC AGG (reversed) Exonic
901740773 1:11340253-11340275 GGGAGCTGGAGAAAATCGGCAGG - Intergenic
903404248 1:23083147-23083169 GGGAAAAAGAGAAAATTGGCAGG - Intronic
907763830 1:57388747-57388769 GGGATAAGAAGAAAACCAGAAGG - Intronic
910582139 1:88840194-88840216 GGGATGAGGAGACAATCTGCTGG + Intergenic
915036174 1:152927236-152927258 GGCATCAGGAGAAAGTCCTCTGG + Intergenic
919551115 1:198988971-198988993 GGGATAAGCAGAGTATCAGCTGG + Intergenic
922386049 1:225084236-225084258 GGGATAAGGAGGCAATCAGCTGG + Intronic
1065945083 10:30598941-30598963 GGGACAAGGAGAAAAGCAGTGGG + Intergenic
1070513458 10:77181719-77181741 AGGATAAGGAGAAAATAAGGAGG + Intronic
1071075417 10:81745670-81745692 AGAATAAAGAGAAAATCAGCTGG + Intergenic
1072717866 10:97763336-97763358 GGAATTAGGAGAAAAGCCACTGG + Intergenic
1074879923 10:117647785-117647807 GCGCTAAGGAAAAAATCTGCAGG - Intergenic
1075926336 10:126254504-126254526 GAGATGAGGAGAGCATCCGCAGG - Intronic
1076258061 10:129044630-129044652 GGGAGAAGGAGAGAATGCGAAGG - Intergenic
1081202217 11:40230419-40230441 GGGAGAAGAAGAAAATTGGCAGG + Intronic
1083083964 11:60123584-60123606 TGGATAAGGAGTGAATCCCCAGG - Intergenic
1086009436 11:82081869-82081891 TGGATAATGAGAAAATCAGAGGG + Intergenic
1088462588 11:110097362-110097384 GGAATAAGTAGAAAATCCCATGG + Intronic
1088540661 11:110910489-110910511 GGGATTAGGGGAAAATAGGCTGG - Intergenic
1089173718 11:116533730-116533752 GGGACAAAGAGAAAATCAGAAGG + Intergenic
1089776809 11:120843397-120843419 GGGAGAAGGAGTACATCAGCAGG + Intronic
1093475857 12:19553797-19553819 GGGAAAAGGAGAAAATCTTAAGG - Intronic
1094401563 12:30066630-30066652 GGGATGATGAGAGAATCTGCTGG + Intergenic
1098669968 12:73215281-73215303 GGGTTAAAGAGAAAATCAACAGG - Intergenic
1103449850 12:121020951-121020973 AGGTTAAAGAGAAAATCCGGAGG - Exonic
1105901832 13:24762070-24762092 AGGATAAGGAGAATATGGGCCGG + Intergenic
1106664961 13:31842120-31842142 GGGATAAGGAGATATTTGGCTGG + Intergenic
1108051760 13:46450511-46450533 GGGATGAGGAGACATTCAGCTGG + Intergenic
1108649601 13:52463713-52463735 GGGATAAGGAGGCATTCTGCTGG + Intronic
1109539531 13:63755701-63755723 GGGATGAGGAGACATTCAGCTGG - Intergenic
1109544313 13:63824133-63824155 GGGATGAGGAGACATTCAGCTGG + Intergenic
1109672529 13:65627793-65627815 GGGATAGGCAGAAACTCCACTGG + Intergenic
1110761319 13:79233690-79233712 GGGATGAGGAGACCTTCCGCTGG - Intergenic
1110925085 13:81140913-81140935 GGGATCTGAAGAAAATCCCCAGG + Intergenic
1112542859 13:100334334-100334356 GGGGGAAGGAGAAAAGCCGCAGG - Intronic
1113255506 13:108500553-108500575 GGAAGAAGGAGAAAAACAGCAGG - Intergenic
1113298523 13:108988891-108988913 GGAATAAGGAGAAAAAGCACTGG - Intronic
1118315249 14:64722077-64722099 GGGGGAAGGACAAAAGCCGCTGG + Intronic
1119980999 14:79080930-79080952 GGGATAAGAAGATAAACCACCGG - Intronic
1120759802 14:88275071-88275093 GGTATCAGGAGAAAAGGCGCAGG - Intronic
1125821465 15:42635703-42635725 GAGATAAGTAGAAATTCAGCAGG - Intronic
1127035011 15:54906241-54906263 AGGAGAAGGAGGAAATCTGCTGG + Intergenic
1127285000 15:57524642-57524664 AGTATAAGGAGAAAAACCGCAGG + Exonic
1129835999 15:78706225-78706247 AGGTTAAAGAGAAAATCAGCAGG + Intronic
1130511403 15:84592729-84592751 AGGTTAAAGAGAAAATCAGCAGG - Intergenic
1137522439 16:49205975-49205997 GGGAAAAGGAGAAAAACAGAGGG + Intergenic
1139076364 16:63454096-63454118 GGGATGAGGAGGAATTCTGCTGG - Intergenic
1142646984 17:1320520-1320542 AGGATAAAGAACAAATCCGCAGG + Intergenic
1144641819 17:16941413-16941435 GGGATAAGGAGAACTTCCAAGGG - Intronic
1147317462 17:39627661-39627683 GGGATCAGGACCAAAGCCGCGGG - Intronic
1147732030 17:42609995-42610017 GGGATAAGAAGTCAAGCCGCAGG - Intronic
1150510411 17:65746302-65746324 GGAATAAGGAGAGATTCCTCTGG + Intronic
1151679752 17:75617057-75617079 GGGATACGGAGAAAGTACACGGG - Intergenic
1157030590 18:43902566-43902588 GGGATACGGAGACATTCCGCTGG - Intergenic
1157392558 18:47314917-47314939 GGGATTAGGAGCAATTCTGCTGG + Intergenic
1159170812 18:64763956-64763978 AGGATCAGGAGTACATCCGCAGG - Intergenic
1163646351 19:18491566-18491588 GGGACAAGGTCAAAATCTGCAGG - Intronic
1164845461 19:31428890-31428912 GGAAGAAGGTGAAAATCCTCTGG - Intergenic
1165215171 19:34266030-34266052 GGGAAAAGGAGAAAATGCTCAGG - Intronic
927818227 2:26239624-26239646 GGGATAAAGAGAAAATACGGAGG - Intronic
928470985 2:31575560-31575582 AGGATGAGGAGAAATTCCGCTGG + Intronic
932453896 2:71834105-71834127 GGAATGAGGAGAAAATTCACTGG + Intergenic
934490883 2:94761463-94761485 GGGACAGGGAGAAAAGCCGGTGG + Intergenic
935614922 2:105068565-105068587 GGGATAAGGGCAAACTCCTCTGG - Intronic
936830846 2:116644248-116644270 GGGATAAGGAGGCATTCTGCTGG + Intergenic
939645604 2:144694638-144694660 GGTATAAGTAGAAAAACTGCAGG - Intergenic
940083169 2:149827892-149827914 GAGATAAGGAGGAAATTGGCTGG - Intergenic
943493887 2:188593520-188593542 GGAATAAGGTGAAAATCATCAGG + Intronic
944325549 2:198399758-198399780 GGGATAAGGAGAAGACCTGCTGG + Intronic
945180551 2:207087037-207087059 GGAATAAGGAGAAACTCTCCTGG + Intronic
945677578 2:212874405-212874427 GGGATAAGGAGGCATTCTGCTGG - Intergenic
1170248203 20:14247847-14247869 GGGATGAGGAGGAATTCTGCTGG - Intronic
1171291935 20:23987347-23987369 GGGATAAGGATAAAGTCCAAAGG + Intronic
1171562433 20:26137180-26137202 GGGATAAGGGGAAAAGACGGTGG + Intergenic
1173820392 20:46015849-46015871 GGGATAAGCAGAAAAAATGCAGG - Intronic
1176236166 20:64054492-64054514 GGGAGAGGGAGAACATCCTCAGG + Intronic
1182290481 22:29274559-29274581 GGGAACAGGGGAAAATCAGCTGG - Intronic
1183443020 22:37834054-37834076 GGGAGAAGCAGAAAATGCCCTGG - Intronic
949850441 3:8415219-8415241 GGGAGAAGGAGAGAAACCACTGG - Intergenic
957310491 3:78512263-78512285 GGGTTAAGGAGAAAAATCGAAGG + Intergenic
958604850 3:96344012-96344034 GGCAGATGGAGAAAATCCACTGG + Intergenic
961824654 3:129592690-129592712 AGGATAAGGGGAAAAAACGCTGG - Intronic
967017562 3:185495826-185495848 AGGATAAGGATAAAAGCCTCAGG + Intronic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
974976864 4:68903450-68903472 GGGAAAAGGAGACCATCCTCTGG - Intergenic
976623002 4:87148160-87148182 GGTAAATGGAGAAAATCCACAGG - Intergenic
977662078 4:99600684-99600706 GGGATGAGAAGCAAATCCACAGG - Exonic
981922507 4:150100502-150100524 GGGATAAGTAGTAAGTCAGCTGG - Intronic
982704439 4:158692064-158692086 GTGAGAAGGAGAAAATCTGCTGG - Intronic
983657220 4:170095296-170095318 GGGATGAGGAGTCAATCTGCTGG + Intergenic
984690078 4:182716470-182716492 GAGATAAGCAGAGAATCCACAGG - Intronic
986042115 5:4003885-4003907 GGGATAAGAAGAAAAAGGGCAGG + Intergenic
995638808 5:114229384-114229406 GGAATAAGGAGAAAATAACCAGG - Intergenic
1000127190 5:158257538-158257560 GGGATAAGGAGAATAGGCTCAGG - Intergenic
1003263233 6:4543166-4543188 GGGATGAGGAGGAAAGCTGCTGG + Intergenic
1003760360 6:9172756-9172778 TAGATAAGGAGAAAATCTCCGGG - Intergenic
1005506901 6:26477343-26477365 AGGTTAAAGAGAAAATCAGCTGG - Intergenic
1005648071 6:27861017-27861039 GGAACAAGGAGAAAAGTCGCTGG - Intronic
1012139630 6:95608169-95608191 GACATAAGAAGAAAATCCACAGG - Exonic
1013291275 6:108720775-108720797 GGGATAAAAAGAGAATCAGCTGG - Intergenic
1013356471 6:109349980-109350002 GAGAGAAGGAAAAAATCCCCTGG - Intergenic
1013376082 6:109515614-109515636 GAGATAAGGAGAAACTCAGGGGG + Intronic
1017194969 6:151690264-151690286 CGAATAAAGAGAAAATCGGCTGG + Intronic
1017739098 6:157390311-157390333 AAGATAAAGAGAAAATCAGCTGG - Intronic
1019595993 7:1858659-1858681 GGGATAGTGAGAACATGCGCAGG + Intronic
1029011519 7:97267128-97267150 AGGATAAGGAGAAAATACTGGGG - Intergenic
1030594766 7:111524852-111524874 GGGGCAAAGAGAAAATCCACTGG - Intronic
1032474804 7:132204381-132204403 GGAATAATGAGAAAATCACCAGG - Intronic
1034271662 7:149806106-149806128 GGGAAAAGGTCAAAATCCCCAGG - Intergenic
1036025993 8:4909670-4909692 GTGAGAAGGAGAAAATCCGGGGG - Intronic
1037755738 8:21709100-21709122 TGGATAATGAGCAAAGCCGCTGG + Intronic
1038756342 8:30344330-30344352 AGAATAAGGAGAAAAGCCACAGG - Intergenic
1039235453 8:35497771-35497793 GAGATAAGAGGAAAATCGGCTGG + Intronic
1040138241 8:43880518-43880540 GGGATAAGCTGAATATCCACAGG - Intergenic
1042847406 8:73182288-73182310 GTGACAAGGAGAAAATATGCCGG - Intergenic
1045094119 8:98779068-98779090 GGGATAAGGAAACATTCTGCTGG - Intronic
1050595065 9:7196836-7196858 GAGTTTAGGAGAAAATGCGCAGG - Intergenic
1050819503 9:9859808-9859830 GTTATAAGGAGAAAGTCAGCTGG - Intronic
1051901071 9:22041145-22041167 GGGATAAAGAGAAAATGTGTTGG + Intergenic
1052900197 9:33787007-33787029 GGGATGAGGAGAGCATCTGCAGG + Intronic
1053083395 9:35196558-35196580 GGGATAAAGAGAAAATGCCTGGG - Intronic
1053153421 9:35757076-35757098 GGAACAAGGAAAACATCCGCCGG + Exonic
1055397850 9:75892456-75892478 GGGCTCAGGCGAGAATCCGCTGG + Intronic
1057101740 9:92367506-92367528 GGGATAAGGAGGCATTCTGCTGG - Intronic
1059425000 9:114215464-114215486 GGGACAAGGAGAAAATAGGAAGG - Intronic
1059780473 9:117521247-117521269 GGGATTAGGAGAAAAAACGAGGG + Intergenic
1061667015 9:132166467-132166489 GGGATAAGGAGAAAATCCGCAGG - Exonic
1186580842 X:10816572-10816594 GGGATAGTGAGAAAATCTTCGGG - Intronic
1187123061 X:16427719-16427741 TGGATAAGGAGATGATCCTCAGG + Intergenic
1188240153 X:27776495-27776517 TGGGAAAGGAGAAAGTCCGCAGG - Intergenic
1193837359 X:86360300-86360322 GGCATAAGGGGAAAATCCTTGGG - Intronic
1194310371 X:92299121-92299143 GGAGTATGGAGAAACTCCGCAGG - Intronic
1200352102 X:155508547-155508569 GGGATAAGGAGAAAACCTTGAGG + Intronic
1200916395 Y:8574938-8574960 GGGATGAGGATAAAATCTGGAGG + Intergenic