ID: 1061667105

View in Genome Browser
Species Human (GRCh38)
Location 9:132166966-132166988
Sequence TCACCTTGACGTAGTCCTTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061667105_1061667112 21 Left 1061667105 9:132166966-132166988 CCTGAAGGACTACGTCAAGGTGA 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1061667112 9:132167010-132167032 CATGTGGAGACCCCCCTGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 79
1061667105_1061667108 -7 Left 1061667105 9:132166966-132166988 CCTGAAGGACTACGTCAAGGTGA 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1061667108 9:132166982-132167004 AAGGTGAAGGTGGAGCCCTCAGG 0: 1
1: 0
2: 1
3: 28
4: 278
1061667105_1061667109 5 Left 1061667105 9:132166966-132166988 CCTGAAGGACTACGTCAAGGTGA 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1061667109 9:132166994-132167016 GAGCCCTCAGGCATCACATGTGG 0: 1
1: 0
2: 2
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061667105 Original CRISPR TCACCTTGACGTAGTCCTTC AGG (reversed) Exonic
900908869 1:5580100-5580122 TCACCTTGATGGCCTCCTTCAGG + Intergenic
901511971 1:9722001-9722023 TCAGCTTGACGAAGTCATTCAGG - Exonic
910338946 1:86164044-86164066 TCTCCTTGAAGAGGTCCTTCAGG + Intergenic
913020650 1:114786021-114786043 TCTCCTTGAAGAGGTCCTTCAGG + Intergenic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
924328723 1:242921417-242921439 TCCCTTTGACATATTCCTTCAGG - Intergenic
924359540 1:243222881-243222903 TCACCTTTAAGTTGTCCTACTGG - Intronic
1063533548 10:6860488-6860510 TCTCCTTGAAGAGGTCCTTCAGG - Intergenic
1065994261 10:31041676-31041698 TCACCATGACTCTGTCCTTCAGG + Intergenic
1066370431 10:34814872-34814894 TCACCTTGGCGATGGCCTTCCGG + Exonic
1067722106 10:48735884-48735906 GCACCATGCCGTGGTCCTTCAGG - Exonic
1068170941 10:53393775-53393797 TCACCTTGTGTCAGTCCTTCAGG - Intergenic
1070515800 10:77204786-77204808 TCCCCGTGAGGTAGTCTTTCAGG + Intronic
1071006101 10:80885893-80885915 TCTCCTTGAAGAGGTCCTTCAGG - Intergenic
1072926244 10:99620041-99620063 TCACCTTGACGCAGTCGATGGGG + Exonic
1074108390 10:110405309-110405331 TAGCATTGACCTAGTCCTTCCGG - Intergenic
1076816865 10:132919336-132919358 TCACCTTGACGTTGTCATACAGG + Exonic
1077721243 11:4631415-4631437 TCTCCTTGAAGAGGTCCTTCAGG - Intergenic
1087293835 11:96346613-96346635 TCTCCTTGAAGAGGTCCTTCAGG + Intergenic
1091818141 12:3454873-3454895 TCCCTTTGAGATAGTCCTTCAGG + Intronic
1091854144 12:3725278-3725300 TCACCTTGATTTAGGACTTCTGG - Intronic
1099177467 12:79438336-79438358 TCACCTCCACCTAGTCCTTCAGG - Intronic
1099235298 12:80076369-80076391 TCTCCTTGAAGAGGTCCTTCAGG + Intergenic
1099957840 12:89368627-89368649 TCACCTTGAAACAGTCCATCAGG + Intergenic
1104224594 12:126819338-126819360 TCACCTTGACCTAGGCCTGGTGG + Intergenic
1104459599 12:128944716-128944738 TCATCTTGGCGTGGCCCTTCAGG - Intronic
1104711085 12:130987141-130987163 TCCCGTTGACGTAGACTTTCAGG - Exonic
1105447422 13:20469847-20469869 TTACCTGGTCGTAGTCCATCGGG - Intronic
1106448176 13:29855326-29855348 TCAGCTTGATGTAATCATTCCGG + Intergenic
1108277708 13:48827783-48827805 TCTCTTTGATGAAGTCCTTCAGG + Intergenic
1110381623 13:74858100-74858122 TCTCCTTGAAGAGGTCCTTCAGG + Intergenic
1117495903 14:56303518-56303540 TGATCTTTACTTAGTCCTTCAGG + Intergenic
1118134471 14:63007131-63007153 TCACCTTCACTAAGTCCTTTTGG - Intronic
1122394077 14:101410330-101410352 TGACCTTGCCGTAGACTTTCTGG - Intergenic
1131439053 15:92444864-92444886 GCACGTTGACGTGGTGCTTCAGG - Exonic
1136298368 16:29316741-29316763 TGACCTGGAGGTAGTCCTGCAGG + Intergenic
1141863488 16:86733932-86733954 ACACCTTGACGTTGGCCTTCCGG - Intergenic
1154030600 18:10750330-10750352 TCACCTTGTGGTAGTGCTTCAGG + Intronic
1158608644 18:58918794-58918816 TCAGCTTATCGTAGTCCTGCTGG - Exonic
1160548225 18:79676159-79676181 TCACCTTTACGTAGTGGCTCAGG - Intergenic
1165303433 19:34987901-34987923 ACACCTTGACTTTGGCCTTCTGG + Intergenic
1167679045 19:50908355-50908377 TCACGTTGCAGGAGTCCTTCTGG + Exonic
924974654 2:161510-161532 TCACCCTCACGCAGTGCTTCAGG + Intergenic
927385009 2:22522682-22522704 TCTCCTTGAAGAGGTCCTTCAGG - Intergenic
929041942 2:37753110-37753132 GCACCTTGATCGAGTCCTTCTGG - Intergenic
930549644 2:52816197-52816219 TCAGCTTGATGTACTCCTTTTGG + Intergenic
935245781 2:101217933-101217955 TCCCCTGGACGAAATCCTTCAGG - Intronic
946201957 2:218075722-218075744 TCACCTTGATCTCGTCCTGCAGG - Exonic
1176051920 20:63124471-63124493 TTACGTTGACGTAGGCCTGCTGG - Intergenic
1179407323 21:41136678-41136700 GCACCTTGGCGTAGGCCTGCAGG + Intergenic
1179711444 21:43265764-43265786 ACACCTTGACTTTGTGCTTCTGG - Intergenic
1179912889 21:44459724-44459746 TCACCCAGACGTGGCCCTTCAGG + Exonic
1185297503 22:50061621-50061643 TCTCCTTGTCGAACTCCTTCAGG + Exonic
1185364144 22:50428225-50428247 TCTCCTTGACTTAATTCTTCTGG + Intronic
1203294154 22_KI270736v1_random:24628-24650 GCACCTTGATCGAGTCCTTCTGG - Intergenic
949233034 3:1773897-1773919 GCACCTTGACTTAGAACTTCTGG - Intergenic
949714261 3:6910375-6910397 TCACCTTCAAGTAGTCAATCAGG + Intronic
952136803 3:30431906-30431928 TCTCCTTGAAGAGGTCCTTCAGG - Intergenic
953028877 3:39163234-39163256 ACACCTTGACTTAGGACTTCTGG - Intergenic
957326325 3:78699752-78699774 TCTCCTTGACCTAGCCCTACTGG + Intronic
957688268 3:83533298-83533320 TCACCTTGTGTTAGTCCCTCCGG + Intergenic
958561817 3:95757759-95757781 TCTCCTTGAAGAGGTCCTTCAGG - Intergenic
960343776 3:116507113-116507135 TCTCCTTGAAGGGGTCCTTCAGG + Intronic
967222176 3:187256660-187256682 TCACCTTGATGTAGTCATAGGGG + Exonic
967925808 3:194646160-194646182 TTACACTGACATAGTCCTTCAGG + Exonic
972130773 4:35830814-35830836 TCTCCTTGAAGAGGTCCTTCAGG + Intergenic
975021560 4:69497138-69497160 TCTCTTTGAGGTATTCCTTCAGG + Intronic
975869117 4:78758643-78758665 TCTCCTTGAAGAGGTCCTTCAGG - Intergenic
978610202 4:110529530-110529552 TAACTTTGACTTAGTCCTGCAGG + Intronic
982082641 4:151805765-151805787 GCACCTTGACCTAGGACTTCTGG + Intergenic
982985087 4:162196951-162196973 TCACCTTGACTAAGTTCCTCTGG - Intergenic
985198827 4:187462814-187462836 GCACCTTGACGTTGGACTTCTGG - Intergenic
986128741 5:4907950-4907972 TCCCCTTGAGGTGCTCCTTCAGG - Intergenic
988001892 5:25359852-25359874 TCTCCTTGAAGAGGTCCTTCAGG - Intergenic
988691091 5:33573046-33573068 TCTCCTTGAAGAGGTCCTTCAGG - Intronic
993317809 5:86433729-86433751 TCTCCTTGAGGAGGTCCTTCAGG + Intergenic
995730284 5:115232230-115232252 TCACCTTCACTTAGTTCTTCTGG - Intronic
998976033 5:147648946-147648968 TCACCTTGACCTTTTTCTTCAGG - Intronic
1002657110 5:180758374-180758396 TCTCCTTGAAGAGGTCCTTCAGG + Intergenic
1005136580 6:22575598-22575620 TCATTTTGACATAGTACTTCAGG - Intergenic
1006147682 6:31969141-31969163 TCACCTTCAGGTAGTCCCCCAGG + Intronic
1019057026 6:169231393-169231415 GCACCTTGACGTTGTGTTTCAGG + Intronic
1019553166 7:1614013-1614035 TCACTTTGAGATATTCCTTCAGG + Intergenic
1026391672 7:69908939-69908961 TCACCTTGGCATAGTCCATTGGG + Intronic
1026858346 7:73769383-73769405 TCCCTTAGACGTAGTCCTTGCGG + Exonic
1027711818 7:81613683-81613705 TCACCTTCACTAAGTTCTTCTGG + Intergenic
1028561931 7:92185441-92185463 TCTCCTTGAAGGGGTCCTTCAGG + Intergenic
1031417728 7:121512456-121512478 TCACCTTTACTGAGTCCCTCTGG - Intergenic
1032506825 7:132441897-132441919 TCACTTTGGAGAAGTCCTTCAGG + Intronic
1034358570 7:150473851-150473873 TCACCTTGATGGAGAGCTTCTGG + Intronic
1045200084 8:99971673-99971695 TCTCCTTGAAGATGTCCTTCAGG - Intronic
1049053788 8:140219383-140219405 TCCCTTTGAGATAGTCCTTCCGG + Intronic
1051223203 9:14872362-14872384 TCTCCTTGAAGAGGTCCTTCAGG + Intronic
1059116330 9:111603113-111603135 TCACTTTGAGATATTCCTTCAGG - Intergenic
1061667105 9:132166966-132166988 TCACCTTGACGTAGTCCTTCAGG - Exonic
1185467068 X:361491-361513 CCACGTTGACGGAGTCCTGCGGG + Exonic
1191828996 X:65394897-65394919 TCTCCTTGAAGAGGTCCTTCAGG + Intronic
1194550121 X:95287379-95287401 TCACCTTGAGGCAGTGATTCTGG - Intergenic
1195820103 X:108935399-108935421 TCTCCTTGAAGAGGTCCTTCAGG + Intergenic
1197371273 X:125628575-125628597 GCACCTGGAGGTAGCCCTTCTGG + Intergenic
1200382477 X:155853339-155853361 TCTCCTTGAAGAGGTCCTTCTGG + Intergenic
1201226105 Y:11820463-11820485 TCCCTTTGACATATTCCTTCAGG - Intergenic
1202350238 Y:23982007-23982029 TCTCCTTGAAGAGGTCCTTCAGG + Intergenic
1202520541 Y:25688114-25688136 TCTCCTTGAAGAGGTCCTTCAGG - Intergenic