ID: 1061678660

View in Genome Browser
Species Human (GRCh38)
Location 9:132231883-132231905
Sequence CTGGGCAGAGAGCAGGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1081
Summary {0: 1, 1: 0, 2: 13, 3: 121, 4: 946}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061678642_1061678660 18 Left 1061678642 9:132231842-132231864 CCTGGGTCCCTGCCTCTCTTGGG 0: 1
1: 0
2: 3
3: 40
4: 447
Right 1061678660 9:132231883-132231905 CTGGGCAGAGAGCAGGGGCTTGG 0: 1
1: 0
2: 13
3: 121
4: 946
1061678640_1061678660 29 Left 1061678640 9:132231831-132231853 CCTGCTTCTAGCCTGGGTCCCTG 0: 1
1: 0
2: 2
3: 26
4: 330
Right 1061678660 9:132231883-132231905 CTGGGCAGAGAGCAGGGGCTTGG 0: 1
1: 0
2: 13
3: 121
4: 946
1061678651_1061678660 6 Left 1061678651 9:132231854-132231876 CCTCTCTTGGGGTGGGAGGGTCG 0: 1
1: 0
2: 1
3: 22
4: 221
Right 1061678660 9:132231883-132231905 CTGGGCAGAGAGCAGGGGCTTGG 0: 1
1: 0
2: 13
3: 121
4: 946
1061678648_1061678660 10 Left 1061678648 9:132231850-132231872 CCTGCCTCTCTTGGGGTGGGAGG 0: 1
1: 1
2: 4
3: 43
4: 324
Right 1061678660 9:132231883-132231905 CTGGGCAGAGAGCAGGGGCTTGG 0: 1
1: 0
2: 13
3: 121
4: 946
1061678647_1061678660 11 Left 1061678647 9:132231849-132231871 CCCTGCCTCTCTTGGGGTGGGAG 0: 1
1: 1
2: 3
3: 26
4: 280
Right 1061678660 9:132231883-132231905 CTGGGCAGAGAGCAGGGGCTTGG 0: 1
1: 0
2: 13
3: 121
4: 946

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061678660 Original CRISPR CTGGGCAGAGAGCAGGGGCT TGG Intronic
900094080 1:933344-933366 CAAGGCAGAGACCAGGGGCGGGG + Intronic
900113944 1:1020696-1020718 CCGGGCGGGGAGCGGGGGCTGGG + Intronic
900148639 1:1168830-1168852 CTGGGCTGGGACCAGGTGCTGGG + Intergenic
900203009 1:1419767-1419789 CTGGGCAGCGGGCAGGGTGTTGG - Intronic
900317931 1:2068748-2068770 CTGGGCAGAGAGCATTTCCTGGG - Intronic
900379903 1:2378544-2378566 CCGTGCAGTGAGCAGGTGCTCGG + Intronic
900425452 1:2576324-2576346 CAGGGCAGAGAGAGGGCGCTTGG + Intergenic
900438513 1:2642369-2642391 GTGGGCAGAGTGGAAGGGCTGGG - Intronic
900580761 1:3407502-3407524 CTGGGCAGGAGTCAGGGGCTGGG + Intronic
900762308 1:4481614-4481636 GTGGGGAGAGAGCAAGGTCTGGG - Intergenic
900767609 1:4515609-4515631 CAGGGCAGAGAGCTGGGGTCTGG - Intergenic
900813504 1:4826043-4826065 GTGGGCAGGTGGCAGGGGCTGGG - Intergenic
901053104 1:6435570-6435592 CGGGGCAAAGGGCAAGGGCTTGG + Intronic
901059198 1:6464315-6464337 CTGGGAGCAGAGCAGGGGCCTGG - Intronic
901061337 1:6473357-6473379 CTGGGCAGAGAGCAGCTGGAGGG + Exonic
901081181 1:6585216-6585238 CTGGGCAGAGAGAAGAGCCAGGG + Intronic
901277590 1:8004785-8004807 CTGTGAAGATAGCACGGGCTGGG - Intronic
901405211 1:9040519-9040541 CTGGGCATAGAGCTGGGAGTGGG - Intronic
901768058 1:11516213-11516235 AAGGGCAGAGACCAGCGGCTAGG - Intronic
901769644 1:11523860-11523882 ATGGGCAGAGGGAAGAGGCTGGG - Intronic
901796626 1:11683220-11683242 CAGGGCAGAGGGCTGGGGCTGGG - Intronic
901965744 1:12864287-12864309 CTGAGCAGAGAGGAGGCCCTGGG - Intronic
901981143 1:13034664-13034686 CTGAGCAGAGAGGAGGCCCTGGG - Intronic
902000943 1:13194265-13194287 CTGAGCAGAGAGGAGGCCCTGGG + Intergenic
902020173 1:13339969-13339991 CTGAGCAGAGAGGAGGCCCTGGG + Intergenic
902163434 1:14550894-14550916 CTGGGGAGAGAGCTGGGGATGGG - Intergenic
902273919 1:15325841-15325863 TTGGACAGGGAGCAGGGCCTTGG - Intronic
902286157 1:15409923-15409945 CTGCGCTGAGAGCAGGGGCCCGG + Exonic
902392986 1:16116905-16116927 CTGGGGAGACAGCAAGGGGTGGG - Intergenic
902396653 1:16135601-16135623 CTGGGCCGACAGCAGGGGACAGG - Intronic
902397708 1:16141580-16141602 CTGGCCTGAGAGCCTGGGCTGGG - Intronic
902414058 1:16228617-16228639 CTGGTCAGAGAGCAGGTGGAGGG - Intergenic
902481137 1:16712479-16712501 CGGGGCAAAGGGCAAGGGCTTGG - Intergenic
902631167 1:17705533-17705555 CTGGGCCATGAGCTGGGGCTGGG + Intergenic
902631174 1:17705551-17705573 CTGGGGCTAGAGCTGGGGCTGGG + Intergenic
902636130 1:17736174-17736196 GTGGACAGGGAGCAGGTGCTGGG + Intergenic
902705280 1:18200008-18200030 GTGGGGAAGGAGCAGGGGCTTGG - Intronic
903044016 1:20552688-20552710 CTGGGAAGCGAGGAGGGGCCGGG - Exonic
903056879 1:20642149-20642171 CTGGGGAGAGAGCAGGGCACCGG - Intronic
903139145 1:21328248-21328270 CCTGGCAGAGAGCAGGAGCAGGG - Intronic
903259561 1:22124047-22124069 CTGGGCAGAGATGAGGAGCTGGG - Intronic
903450501 1:23450812-23450834 CTGGGCAGAGGGCAAAGGCTGGG + Intronic
903543249 1:24108432-24108454 CTGGGAACAGGGCAGTGGCTGGG + Intronic
903773378 1:25778064-25778086 TTGGGCAGGGAGAAGGGGCGTGG - Intronic
903814047 1:26051713-26051735 CTGCTCAGAGAGCAGGGACTAGG - Exonic
904006143 1:27364251-27364273 CAGGGGAGTGAGCAGGGCCTCGG + Exonic
904056254 1:27672316-27672338 CTCTGCAGAGTGCAGGAGCTGGG - Intergenic
904612461 1:31732961-31732983 CTGCGCCGAGAGGTGGGGCTGGG - Exonic
904660063 1:32077355-32077377 CAGGGCAGAGGTCAGGGGCCAGG - Intronic
904903667 1:33877822-33877844 CTGAAAAGAGGGCAGGGGCTTGG - Intronic
905067926 1:35199233-35199255 CTGTGCAAAGAGCCGGGGCGGGG - Intergenic
905171964 1:36114905-36114927 ATGGGCAGAGGCCAGGGGCTTGG - Intronic
905224274 1:36468970-36468992 CTGGACAGAAATCAGGTGCTGGG - Intronic
905515197 1:38557672-38557694 CTGGACTCAGAGCAGAGGCTGGG - Intergenic
905541667 1:38764955-38764977 CTGAGGAGAGACCAGGGGGTGGG + Intergenic
905886466 1:41494574-41494596 CTAGGAAGAGGGCAGGGCCTGGG + Intergenic
905919580 1:41710577-41710599 CTGGGCTGAGAGCAAGGAGTAGG - Intronic
905942462 1:41874967-41874989 CTGGGCAGAGACAAGTGGCGAGG - Intronic
906484268 1:46222195-46222217 CTGAGGAGAGAGCAGAGCCTGGG + Intergenic
906545405 1:46616490-46616512 CGGGGCAGAGGGGAGGGGTTGGG - Intronic
906693660 1:47809800-47809822 CTGGGCTGGGAGCAGGGACCAGG + Intronic
906694051 1:47812059-47812081 CTGGGCAGAGTGGAGGCCCTGGG - Intronic
907439634 1:54471275-54471297 CAGGCCAGAGAAGAGGGGCTGGG + Intergenic
907454690 1:54567785-54567807 CTGGGCAGAGAGGTGGAGCCAGG - Intronic
907485759 1:54777054-54777076 CTGTTCAGACAGCAGGGGCCAGG - Intergenic
907666328 1:56436525-56436547 CTGGGCACAGAGTAGGTGCCAGG - Intergenic
908501215 1:64745218-64745240 CTGGGCAGCGCGGCGGGGCTGGG + Exonic
908790428 1:67775683-67775705 CTGGGAAGTGAGTAGGAGCTAGG + Intronic
909600491 1:77456527-77456549 CTGGGCAGAGAGCATGTGCCAGG + Intronic
910707192 1:90142297-90142319 CAGAGCAAAGAGCAGGAGCTGGG + Intergenic
912701503 1:111881654-111881676 CAGGGCAAAGGGCAGGGGCATGG + Intronic
915038265 1:152946828-152946850 GTTGGCAGAGAGGAGGGGATGGG - Intergenic
915098899 1:153484529-153484551 CTGGGCTGACAGCGGGGGCGTGG - Intergenic
915316318 1:155030941-155030963 CTGCCCTGAGAGCAGGAGCTGGG - Intronic
916207336 1:162328091-162328113 CTGTGGAAAGAGCATGGGCTTGG - Intronic
916243335 1:162661428-162661450 CTGGGCAGACTGTATGGGCTTGG + Intronic
916246845 1:162696797-162696819 CTGGGCAGACAGCGGGGGCAGGG - Intronic
916470317 1:165117332-165117354 GTGGGCACAGAGGAGGGGATTGG - Intergenic
916730831 1:167565252-167565274 CTGGGCATAGAACAGTGCCTGGG + Intergenic
917330447 1:173874644-173874666 CTGGGCTGGGTGCAGTGGCTGGG - Intronic
917974308 1:180229563-180229585 GGGGAGAGAGAGCAGGGGCTGGG + Intergenic
918245729 1:182657499-182657521 TTGGGGAGGGAGCAGGGTCTGGG - Intronic
919798747 1:201337878-201337900 GTGGGCACAGAGCAGAGGCTTGG + Intergenic
919806208 1:201382390-201382412 CTGGGCTGGGAGCTGGGCCTGGG - Intronic
920051239 1:203166248-203166270 CTGGGCTGGGAGAAGGTGCTTGG + Exonic
920204542 1:204282101-204282123 CCAGGCCCAGAGCAGGGGCTGGG - Intronic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
920664896 1:207956122-207956144 CCTGGCAGAGGCCAGGGGCTGGG - Intergenic
921053475 1:211527132-211527154 ATGGGGAGAGAGCAGGGCCTGGG + Intergenic
921257663 1:213357016-213357038 AGGGGCAGAAAGCAGGGGCCAGG + Intergenic
921326132 1:213987760-213987782 CTGGGAAGAGAGGAGGGGAGAGG - Intronic
921427067 1:215015874-215015896 CAGGGCAGAGATCATGAGCTTGG + Intronic
922087785 1:222367749-222367771 GTGGTCAGAGAGCAGGAGCAGGG - Intergenic
922619419 1:226980895-226980917 CGGGGCAGAGGGCAGTGGCACGG + Intronic
922748647 1:228060674-228060696 GAGGGCAGGGAGGAGGGGCTGGG - Exonic
922762611 1:228142085-228142107 CTGGGGAGAGACCAGTGGCAGGG - Intronic
923065974 1:230517809-230517831 CTTTGCAGGGAGCAGGAGCTTGG + Intergenic
923105498 1:230850706-230850728 CTGGGCAGAGATGGGGGTCTCGG + Intronic
924309196 1:242722396-242722418 CGGGGCAGGGGGCAGGGGCAGGG - Intergenic
924642427 1:245847012-245847034 ACAGGGAGAGAGCAGGGGCTTGG - Intronic
1062835861 10:635422-635444 CTGTACAGAGACCAGGGACTGGG + Intronic
1062927288 10:1326842-1326864 CTGGGCAGTGGGGAGGCGCTGGG - Intronic
1062927305 10:1326896-1326918 CTGGGCAGTGGGGAGGCGCTGGG - Intronic
1062927311 10:1326914-1326936 CTGGGCAGTGGGGAGGCGCTGGG - Intronic
1062927336 10:1326986-1327008 CTGGGCAGTGGGGAGGCGCTGGG - Intronic
1062927353 10:1327040-1327062 CTGGGCAGTGGGGAGGCGCTGGG - Intronic
1062927393 10:1327253-1327275 CTGTGCAGTGAGGAGGCGCTGGG - Intronic
1062927428 10:1327415-1327437 CTGGGCAGTGGGGAGGCGCTGGG - Intronic
1062927441 10:1327451-1327473 CTGTGCAGTGAGGAGGCGCTGGG - Intronic
1062927459 10:1327541-1327563 CTGGGCCGTGAGGAGGCGCTGGG - Intronic
1062927463 10:1327559-1327581 CTGTGCAGTGAGGAGGCGCTGGG - Intronic
1063142558 10:3268322-3268344 CTGGGCAGAATGCAGGGCATGGG - Intergenic
1063494494 10:6494378-6494400 ATGGACAGAGAACAGTGGCTGGG - Intronic
1063968301 10:11363615-11363637 CAGGGCAGAGGGCTGGGGCGAGG + Intergenic
1064280684 10:13948591-13948613 CTGAGCAGAGAGCAGGTGGTGGG + Intronic
1064281803 10:13957997-13958019 CTGTGCCGAGAGCAGGATCTAGG - Intronic
1064432016 10:15279368-15279390 CGGGGCAGAGGACAGGGACTAGG + Intronic
1066094093 10:32056266-32056288 CTGGGCGGACTGCGGGGGCTGGG + Exonic
1066143813 10:32535610-32535632 CTAGGTAAAGAGAAGGGGCTTGG + Intronic
1067095305 10:43295589-43295611 CCGGGCCGAGGGCAGTGGCTGGG + Intergenic
1067242642 10:44509238-44509260 CTGGGGAGAGAGGAAGGTCTAGG + Intergenic
1067409927 10:46055377-46055399 CTGTAAAGAGAGCAGGGGCTTGG - Intergenic
1067439034 10:46297916-46297938 GTGGGCAGAGGTGAGGGGCTGGG + Intronic
1067497304 10:46772998-46773020 CTGGGAAGAGGCCAGGGGCTTGG - Intergenic
1067597348 10:47567417-47567439 CTGGGAAGAGGCCAGGGGCTTGG + Intergenic
1067681277 10:48442854-48442876 GTGGCCTGAGTGCAGGGGCTTGG + Intergenic
1067759357 10:49031929-49031951 CTGGGCTGAGAGCACAGCCTGGG - Intronic
1068030461 10:51698880-51698902 CTGGGCAGAGCCCAGGGCCAGGG + Exonic
1068721732 10:60253211-60253233 TTGGGCAGAGGACAAGGGCTTGG + Intronic
1068935516 10:62632217-62632239 CAGTGGAAAGAGCAGGGGCTGGG - Intronic
1069456886 10:68560755-68560777 CGGGGCAGAGGGCAGGGGTGCGG + Intronic
1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG + Intronic
1069755379 10:70771567-70771589 CAGAGCTGAGAGCAGGAGCTGGG - Intronic
1069757907 10:70785132-70785154 AGGGACAGAGAGCAGGGGCAGGG - Intronic
1069829962 10:71277000-71277022 CAGGGCTGAGAGGAGGGGCGGGG + Intronic
1069832512 10:71289839-71289861 GTGGGCAGACATCCGGGGCTGGG + Intronic
1069898323 10:71692635-71692657 CTGAGCAGGGAGCTGGGGGTGGG - Intronic
1070140696 10:73735027-73735049 CTGGGAAGAGGCCAGGGCCTTGG + Intergenic
1070383849 10:75906044-75906066 CTGGGGTGAGAGCTGGGACTGGG - Intronic
1070752039 10:78969659-78969681 CTGAGCACAGAGCAGGGCATGGG - Intergenic
1070761133 10:79025034-79025056 CTCGGCAGAGAGCTGGATCTGGG + Intergenic
1070784600 10:79155687-79155709 CTGGACAGGGAGCAAGGCCTTGG + Intronic
1070932242 10:80269547-80269569 CTTGGCACAGAGTAGGTGCTTGG - Intergenic
1071375402 10:84997125-84997147 CTGGGCTGAAGCCAGGGGCTGGG + Intergenic
1071571454 10:86699627-86699649 CTGTGCAGAGGGCAGGGGATTGG - Intronic
1072045522 10:91650935-91650957 CTGGCAAGAGAGCAGAGGGTAGG + Intergenic
1072418353 10:95268544-95268566 CTGGGCTGGAAGCAGGGGGTCGG - Intronic
1072440624 10:95451332-95451354 CTTGGCAGTGAGCAGGCACTGGG - Intronic
1072620533 10:97076258-97076280 CTGAGCAGGGAGCCAGGGCTGGG - Intronic
1072661647 10:97367016-97367038 CTGTGCACTGAGCAGGGGCGGGG - Intronic
1073064676 10:100750962-100750984 CTGGACAAAGAGCAGAGACTGGG - Intronic
1073122520 10:101131463-101131485 GGGGGCAGCTAGCAGGGGCTGGG - Exonic
1073300659 10:102469266-102469288 CTGGGCAGATTGCAGGTGCCTGG + Intronic
1074678885 10:115882960-115882982 ATGGGCAGAGAACATGGGCAAGG - Intronic
1074792950 10:116910209-116910231 CTTGGCAGAGAGTAGGGGAGAGG + Intronic
1074860818 10:117509004-117509026 CTGGACAGAGTGAAGAGGCTGGG + Intergenic
1075355408 10:121768450-121768472 TAGGTCAGAGAGGAGGGGCTGGG + Intronic
1075671382 10:124265999-124266021 CTGGGCACTGTGCTGGGGCTGGG - Intergenic
1075925146 10:126245501-126245523 CTGGGCAGTGGGCAGGAGGTCGG + Intronic
1076007141 10:126956762-126956784 CAGGGCACAGAACAGGGGTTTGG + Intronic
1076226107 10:128777091-128777113 CTGGCAAGAGAGCAGTGTCTGGG - Intergenic
1076367853 10:129933876-129933898 CTGAGCAGAGAGGAGGGGAGAGG - Intronic
1076450660 10:130554832-130554854 CTGGGATAATAGCAGGGGCTAGG + Intergenic
1076546887 10:131251308-131251330 CTGGGCTGGGAGGAGGGGCCGGG - Intronic
1076639615 10:131905387-131905409 CAGGAGAGGGAGCAGGGGCTGGG - Intronic
1076691335 10:132225177-132225199 GGGGGCAGAGAGCAGGGGCCTGG + Intronic
1076717892 10:132375762-132375784 CTGGGCAGGGAGCAGGGGAAAGG - Exonic
1076761534 10:132608343-132608365 CTGTGCAGAGAGTGGGTGCTGGG + Intronic
1076769852 10:132656920-132656942 CTGGGCAGACAGCAGCGACAGGG + Intronic
1076790597 10:132775000-132775022 AGGGGCAGAGAGGAGGGGCAGGG + Intronic
1076790662 10:132775160-132775182 AGGGGCAGAGAGGAGGGGCAGGG + Intronic
1076812919 10:132898558-132898580 CAGGGCAGGGGGCGGGGGCTGGG - Intronic
1076824992 10:132962472-132962494 GTAGGCAGAGAGCAGCCGCTTGG - Intergenic
1076919563 10:133444675-133444697 CTGGCCAGAGATCAGGAGGTAGG - Intergenic
1076919877 10:133445962-133445984 GTGGGGGGAGAGCAGAGGCTGGG + Intergenic
1077023069 11:428267-428289 GTGGTCAGAGAGCAGGGGAGGGG - Intronic
1077048589 11:556681-556703 CGGGGCAGGGAGCAGGGCCAGGG + Intronic
1077089433 11:771722-771744 TTGGGCAGAGTGCTGGGGCGGGG + Intronic
1077094266 11:792681-792703 CTGGGCCGAGAGCTGGCCCTGGG + Exonic
1077156050 11:1092220-1092242 GTGGGAACAGAGCAGGGGCGAGG - Intergenic
1077164694 11:1129768-1129790 CTGGGCGGAGATCAGGGGACAGG - Intergenic
1077249567 11:1555079-1555101 GTGGGAAGAGGCCAGGGGCTTGG - Exonic
1077429207 11:2507683-2507705 CTGGGGAGAGAGTGCGGGCTGGG + Intronic
1077432831 11:2524518-2524540 GTGGTCAGTGAGCAGGGGCGTGG + Intronic
1077490822 11:2860207-2860229 CTGTGCAGAGAGCAGGATGTGGG - Intergenic
1077606489 11:3616137-3616159 CTGGTCAGAGCGGAGGGGCTTGG + Intergenic
1078082334 11:8213259-8213281 CAGGGCAGACAGCAGGGGTGAGG - Intergenic
1078403039 11:11044787-11044809 CTGGGCTGAGAGGAGGGGCTGGG + Intergenic
1080525726 11:33115009-33115031 CTGGGCACATAGCAGAGGCAGGG + Intronic
1080660467 11:34292191-34292213 CTGGGGAGGGAGCAGGGTATAGG - Intronic
1080897116 11:36456033-36456055 CTGTGGAGAGAGCAGGGCCTTGG + Intronic
1081684007 11:45028657-45028679 ATGGGAAAAGAGAAGGGGCTTGG - Intergenic
1081960562 11:47133534-47133556 CAGGCCAGAGGGCATGGGCTGGG - Intronic
1082160516 11:48883798-48883820 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082161850 11:48896608-48896630 CTGAGCAAAGAGGAGGGGGTGGG + Intergenic
1082236127 11:49821606-49821628 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082239585 11:49856152-49856174 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082242569 11:49888199-49888221 CTGAGCAAAGAGGAGGGGGTGGG + Intergenic
1082609630 11:55281526-55281548 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082657055 11:55869002-55869024 CTGAGCAAAGAGAAGGGGGTGGG + Intergenic
1082722904 11:56700764-56700786 CTGGGCATAAAGCAGGGGCTTGG - Exonic
1082726262 11:56740552-56740574 CTGAGCATAAAGCAGGGGCTTGG - Intergenic
1082727307 11:56751537-56751559 CCGGGAATAAAGCAGGGGCTTGG + Intergenic
1082771806 11:57213591-57213613 CTTGAGAGAGAGGAGGGGCTGGG - Intergenic
1082803366 11:57430786-57430808 CTGGGCTTAAGGCAGGGGCTTGG + Intergenic
1083190870 11:61051421-61051443 CAGCACAGAGAGCAGGGGCCTGG + Intergenic
1083258442 11:61510350-61510372 CTGGCCCAGGAGCAGGGGCTTGG + Exonic
1083551828 11:63595906-63595928 CTGGGAAGAGTGCAGGTGTTTGG - Intronic
1083657623 11:64237337-64237359 CGGGGCAGAGAACACAGGCTTGG - Intronic
1083663001 11:64260477-64260499 CTGGGCAGGGAGGTGGGGCAGGG + Intronic
1083689220 11:64396616-64396638 CTGGGGTGAGAGCAGGGGAGGGG + Intergenic
1083779785 11:64911855-64911877 CTGGGCAGAGAGCCGGCGGGAGG + Exonic
1083800957 11:65045998-65046020 AAGGGCAGCGGGCAGGGGCTGGG - Intronic
1083882816 11:65556947-65556969 CTGGGGAGGGTGTAGGGGCTTGG + Intronic
1083887149 11:65578439-65578461 CTGGGCAGAGATGAGTGGCAGGG - Intronic
1084072114 11:66743598-66743620 CCTGGCAGAGAGCAGCAGCTGGG + Intergenic
1084153849 11:67303373-67303395 CTGGGCACAGGTCAGGGGCGAGG - Intergenic
1084233383 11:67769679-67769701 CTGGGCAGTGACCAGTGTCTTGG + Intergenic
1084274391 11:68044099-68044121 GTGGGCAGTCAGCGGGGGCTGGG - Intronic
1084301270 11:68254191-68254213 ATGGGCAGAGAGCAGAGGGAAGG + Intergenic
1084453676 11:69254890-69254912 CTGAGCAGAGAGTAGGTGATGGG + Intergenic
1084456620 11:69271457-69271479 CTGGGCAAAGACAAGGGCCTGGG - Intergenic
1084495430 11:69500637-69500659 CTGGCCAGACAGCAGGTGCAGGG + Intergenic
1084545009 11:69810847-69810869 CTGGGCAGAGGGCAGGGCCTAGG - Intronic
1084578454 11:70006455-70006477 CAGGGCAGAGAGCAGAGGTAGGG - Intergenic
1084947438 11:72646115-72646137 CTGGGAGGAAAGCTGGGGCTGGG - Intronic
1085276857 11:75306136-75306158 CTGGGCACAGAGCAGGGATGGGG - Intronic
1085342691 11:75743756-75743778 TTGGGGAGGGAGCAGGAGCTGGG + Intergenic
1085445316 11:76597439-76597461 CTGGGTAGAGAGCCTGGGCAGGG - Intergenic
1085449226 11:76622054-76622076 CTGGGCAGGGGGCAGGGGGAGGG + Intergenic
1085472816 11:76769026-76769048 GTGGGCAGGAAGCAGGGGCATGG + Intergenic
1087022276 11:93615491-93615513 GGGGGCAGAGAGCAGGTCCTGGG - Intergenic
1088090264 11:106030124-106030146 CTGAGGTGAGAGCAGGGGGTGGG + Intergenic
1088812751 11:113402524-113402546 CTGGGCAGCTAGCAGGGAGTAGG - Intergenic
1089340061 11:117751055-117751077 AGAGGCAGAGGGCAGGGGCTGGG + Intronic
1089360436 11:117882552-117882574 ATTTGCAGAGAGGAGGGGCTTGG - Intergenic
1089401780 11:118168555-118168577 CTGGGCTGAAGGCAGGGGCAGGG - Intronic
1089630291 11:119780042-119780064 CTCTGATGAGAGCAGGGGCTTGG + Intergenic
1089680974 11:120118741-120118763 CTAGGCAGAGGACAGGGTCTGGG - Intronic
1089688123 11:120169703-120169725 CCTGGCACAGAGCAGGCGCTCGG + Intronic
1089792199 11:120953276-120953298 CTGGGAAGAGAGGAGGGGTGGGG + Intronic
1090646268 11:128768852-128768874 CTGCTCAGAGAGCAGAGGCAAGG + Intronic
1091046031 11:132326467-132326489 CTGGTCACTGAGCAGGGGCAAGG + Intronic
1091140185 11:133228000-133228022 CTGCCCTGAGAGCTGGGGCTGGG + Intronic
1091385124 12:89061-89083 GTGAGCATAGAGTAGGGGCTGGG + Intronic
1091787602 12:3252457-3252479 CTGGGGGGAGCCCAGGGGCTGGG - Intronic
1094646365 12:32328404-32328426 CTCGTCAAAGAGCAGCGGCTCGG + Exonic
1096113220 12:49040942-49040964 TGGGGGCGAGAGCAGGGGCTCGG + Exonic
1096186030 12:49581108-49581130 GTGTGCAGAGAGCAGGGGCAGGG + Intronic
1096220839 12:49827646-49827668 TTGGGCAGGGAGCAGGGACAGGG - Intronic
1096393504 12:51248015-51248037 CTAGGCAGAGAGAAGAGCCTGGG + Intronic
1096429989 12:51534910-51534932 CTTGGCAGTGTGCGGGGGCTTGG + Intergenic
1096463558 12:51836217-51836239 CAGGGCAGACAGGCGGGGCTGGG - Intergenic
1096615271 12:52829298-52829320 ATGGGCAGAGAGGAGGGACTGGG - Intronic
1096805760 12:54140295-54140317 CCTGGCAGCGAGCAGGTGCTCGG - Intergenic
1097190154 12:57215963-57215985 GGGGGCAGAGAGCTGGGGCTGGG + Intergenic
1097190284 12:57216449-57216471 CAGGGCAGAGGCCCGGGGCTTGG + Intergenic
1097276244 12:57815410-57815432 CTGGGCTCAGGGCAGGGGTTGGG + Intronic
1098893106 12:76030323-76030345 CTGGGCAGAGAGGGGAGGCTGGG - Intronic
1098918974 12:76285613-76285635 CTGGGCAGAGAGTGGTGGGTGGG - Intergenic
1100315453 12:93441404-93441426 CGGGGCGGAGAAGAGGGGCTTGG + Intronic
1100719540 12:97343205-97343227 CTTGGGATAAAGCAGGGGCTGGG + Intergenic
1100844469 12:98644832-98644854 CCGGGGAGAGGGAAGGGGCTGGG - Exonic
1101234392 12:102774258-102774280 CTGAGCAGAGAGCAGCAGCAGGG + Intergenic
1101332659 12:103769514-103769536 CAGGGCACAGAGCAGGCCCTAGG + Intergenic
1101395338 12:104342165-104342187 CTGGGGAGGGAGCAGGAGATTGG - Intronic
1101438846 12:104687630-104687652 CTGGGCAGTGAGGAGGTTCTGGG + Intronic
1101452064 12:104788945-104788967 AGGGGCAGAAAGCAGGGGCAAGG + Intergenic
1101577716 12:106013550-106013572 CTGGGTAAAAAGGAGGGGCTGGG - Intergenic
1101728636 12:107408464-107408486 CTGGGAAGACAGTAGGGGCAGGG + Intronic
1101760172 12:107651866-107651888 CAGGGCAGAGAGTGGGTGCTGGG + Intronic
1101957290 12:109222734-109222756 CAGGGCAGAAGGCAGAGGCTCGG - Intronic
1102008914 12:109606320-109606342 CTGGGGAGTGAGCTGGGGCATGG + Intergenic
1102078413 12:110078474-110078496 CTGGGAAGCGAGCTGAGGCTGGG + Intergenic
1102188775 12:110970147-110970169 CTGGGCACAGAGAAGGGCCTCGG - Intergenic
1102247207 12:111362960-111362982 CAGGGCAGAGGGCAGGGACGGGG + Exonic
1102519396 12:113469397-113469419 GTGGGAAGAGGTCAGGGGCTGGG - Intronic
1102695952 12:114799704-114799726 CTGGCCCTAGAGCAGGGGCGGGG - Intergenic
1103209530 12:119156508-119156530 CTGGGCCGATAGTAGGGGATGGG - Exonic
1103209793 12:119157781-119157803 CTGGGCAGAGGGGAGGGGGCTGG - Exonic
1103480500 12:121247324-121247346 CTGTGCTGGGAGCAGGGGCTGGG - Intronic
1103536133 12:121634944-121634966 CTGGGGAGAGGGGAGAGGCTGGG - Intronic
1103743953 12:123109607-123109629 TTTGGCAGAGAGCAGAGGCTGGG - Intronic
1103936313 12:124479111-124479133 CTGCGCAGAGAGCAGGCCCGAGG - Intronic
1104756723 12:131274033-131274055 TTGGGCAGAGAGGAGGCGTTGGG - Intergenic
1104763621 12:131312975-131312997 CTGGGCTCAGGGCAGGGGCCCGG - Intergenic
1104944213 12:132408436-132408458 CTGGGCAGAGACCAGGTGAGGGG - Intergenic
1104989631 12:132618553-132618575 CTGGACCAAGAGCTGGGGCTGGG + Intergenic
1105239938 13:18599681-18599703 CTGAGCATAGTGCAGGCGCTGGG + Intergenic
1106788297 13:33129358-33129380 CTGGGCAGAGAGCAGGTCCCTGG - Exonic
1107028669 13:35829136-35829158 CTATGCAGGGAGCAGGGGCCTGG - Intronic
1107196582 13:37659676-37659698 CAAGGCAGAGACCAGGGGCAGGG + Intronic
1107662982 13:42658550-42658572 CAGGGGAGAGAAGAGGGGCTTGG - Intergenic
1112222147 13:97501827-97501849 CTTGCAAGAAAGCAGGGGCTTGG + Intergenic
1112430794 13:99348552-99348574 TTGGGAAGAGAGCAGAGGCCAGG + Intronic
1112924322 13:104655291-104655313 CTGCTCAGAGAGCAGGTGGTGGG + Intergenic
1113055079 13:106259348-106259370 GTGACCATAGAGCAGGGGCTCGG - Intergenic
1113121236 13:106925783-106925805 CTGGGTAATGAGCAGAGGCTGGG - Intergenic
1113365252 13:109669736-109669758 CTTGGCAGAGAGCAGGTAATTGG - Intergenic
1113637461 13:111929443-111929465 CTGCGGAGGTAGCAGGGGCTGGG - Intergenic
1114534124 14:23412376-23412398 CTGGGCAAAGGGCAGCGGTTCGG - Intergenic
1114736780 14:25050231-25050253 CGGGGCAAAGAGCAGCGGCTAGG + Exonic
1114889757 14:26904055-26904077 GGGAGCAGAGAGCAGGTGCTTGG + Intergenic
1115176595 14:30569179-30569201 CTGGGGAGAGAGAAGGGGTAGGG - Intronic
1115429534 14:33300666-33300688 CTGGCCATAGAGCAGGGGAGAGG + Intronic
1115852431 14:37598736-37598758 GTTGGCAGACAGCAGGGCCTGGG + Intronic
1117831100 14:59751819-59751841 CAGTGCAGAGCCCAGGGGCTGGG - Intronic
1120746770 14:88159350-88159372 CTGGGCAGAAAACAGGGTCTTGG - Intergenic
1121144716 14:91574003-91574025 CTGGGCAGGGAGGAGGAGGTTGG + Intergenic
1121178093 14:91906222-91906244 GTGGGGAGAGGGCAGGGGATTGG - Intronic
1121245276 14:92457555-92457577 CTGGCCACATAGTAGGGGCTTGG + Intronic
1121904082 14:97723772-97723794 ATGGGGAGGGAGCAGGGGGTGGG - Intergenic
1121961140 14:98261276-98261298 CTGGGAAGAGAGGAGGGGAATGG + Intergenic
1122328832 14:100899412-100899434 CAGGGCTGAGAGCAAGTGCTGGG + Intergenic
1122366805 14:101199221-101199243 CTGGGCAGGGGGCAGGGGGCAGG + Intergenic
1122423845 14:101594144-101594166 CTGGGCAGAGAGAGAGGGCTGGG - Intergenic
1122853345 14:104548339-104548361 CTGGGCTGGGGCCAGGGGCTGGG - Intronic
1122853423 14:104548642-104548664 CTGGGGAGAACGCTGGGGCTGGG - Intronic
1122853452 14:104548714-104548736 CTGGGGAGAATGCTGGGGCTGGG - Intronic
1122862905 14:104590424-104590446 GTGGACAGACAGCAGCGGCTGGG - Intronic
1122911090 14:104827842-104827864 CGGGGCAGGGAGGAGGGGCTGGG + Intergenic
1123396662 15:19944061-19944083 CTGGGCAGAAAGCCGCGGCGGGG - Intergenic
1123491298 15:20784381-20784403 CTGAGCACAGTGCAGGCGCTGGG - Intergenic
1123547800 15:21353472-21353494 CTGAGCACAGTGCAGGCGCTGGG - Intergenic
1123706630 15:22955505-22955527 GTGGGCAGGCAGCAGGGGCTGGG + Intronic
1123708049 15:22964817-22964839 CTGGGCAGGCAGACGGGGCTGGG - Intronic
1123708152 15:22965763-22965785 CAGGGCAGCGGGAAGGGGCTGGG - Intronic
1124158034 15:27245207-27245229 CTGGGCAGGTAGCAGGTGCCAGG + Intronic
1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG + Intergenic
1124411762 15:29442958-29442980 CTGGACAGAAACCAGGGGCAGGG + Intronic
1124620590 15:31271855-31271877 CTGGGCAGAGAGCCAGGGCAAGG - Intergenic
1125283032 15:38063403-38063425 CTGGGCACAGAGCCGGGGCTTGG - Intergenic
1125533245 15:40427807-40427829 CTGGAAAGAAAGGAGGGGCTGGG - Intronic
1125676748 15:41506085-41506107 CTGGGCATATGGCAGGGGCAGGG - Intronic
1125798328 15:42421343-42421365 CAGGGCAGAGAGGAGTGGCAGGG + Intronic
1125937377 15:43648806-43648828 CTGGGCTGTGGGTAGGGGCTAGG - Exonic
1125950284 15:43746227-43746249 CTGGGCTGGGGGCAGGGGCTAGG - Intergenic
1126300915 15:47195333-47195355 CTGGGCAGAGATAAAGGGCAGGG - Intronic
1127383005 15:58445510-58445532 CTGAGGACAGAGCTGGGGCTAGG + Intronic
1128325598 15:66722084-66722106 ATGGGCAGAGACCAGGACCTGGG + Intronic
1128370513 15:67035898-67035920 CTGGGCAGCGAGTAGGGGTGTGG + Intergenic
1128702443 15:69814114-69814136 CCGGGCACACAGCGGGGGCTGGG - Intergenic
1128779764 15:70351672-70351694 GAGGGCAGTGAGCAGGAGCTCGG - Intergenic
1128923676 15:71634603-71634625 TTGAACAGAGAGCAGTGGCTGGG + Intronic
1129036254 15:72650362-72650384 CTGGGCCCAGTGCAGGTGCTAGG + Intergenic
1129131729 15:73504522-73504544 ATGGGCAGGAAGGAGGGGCTAGG - Intronic
1129200100 15:73993585-73993607 CAGGGTGGAGAGCAGGGGTTGGG - Intronic
1129213635 15:74086862-74086884 CTGGGCCCAGTGCAGGTGCTAGG - Intergenic
1129233406 15:74209151-74209173 TCAGGCACAGAGCAGGGGCTGGG + Intronic
1129258398 15:74347830-74347852 CTGTGGAGAGGGCAGAGGCTGGG - Intronic
1129396768 15:75254223-75254245 CTGGGCCCAGTGCAGGTGCTAGG + Intergenic
1129400378 15:75278500-75278522 CTGGGCCCAGTGCAGGTGCTAGG + Intronic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129473997 15:75771209-75771231 CTGGGCCCAGTGCAGGTGCTAGG + Intergenic
1129714346 15:77838243-77838265 GGAGGCTGAGAGCAGGGGCTGGG - Intergenic
1129730772 15:77931186-77931208 CTGGGCCCAGTGCAGGTGCTAGG - Intergenic
1129790340 15:78336947-78336969 CTGGGCAGAGACCCGGCTCTTGG - Intergenic
1130232653 15:82108679-82108701 GGGAGCAGAGAGCTGGGGCTGGG + Intergenic
1130243330 15:82219253-82219275 GTGGGCAGTGAGCAGGGGATAGG - Intronic
1130457137 15:84122053-84122075 GTGGGCAGTGAGCAGGGAATAGG + Intergenic
1130460504 15:84155913-84155935 CCCTGCACAGAGCAGGGGCTGGG + Intergenic
1131053551 15:89362833-89362855 CTGGACTGAGAGAGGGGGCTGGG + Intergenic
1132175605 15:99711615-99711637 CTGGGCAGAGGCTAGGGGCCTGG - Intronic
1132347834 15:101119122-101119144 GTGGGCTCAGAGCAGGGGATAGG - Intergenic
1202956130 15_KI270727v1_random:80702-80724 CTGAGCACAGTGCAGGCGCTGGG - Intergenic
1132497551 16:270951-270973 CTGGGACTGGAGCAGGGGCTGGG + Intronic
1132513206 16:353974-353996 CTGGGTGGAGAGCAGAGGGTTGG - Intergenic
1132602301 16:778763-778785 CTGGGCAGAGAGGAGGAGACAGG + Intronic
1132669057 16:1095290-1095312 CTGGGCAGAGCCCTGGGGCGTGG + Intronic
1132688543 16:1172243-1172265 CTTGGCAGGGAGTTGGGGCTGGG + Intronic
1132700779 16:1221130-1221152 CTGGGCAGAGAACCAGGGCCTGG - Exonic
1133027095 16:2993202-2993224 CTGAGCAGAGAGGAAGGGATGGG + Intergenic
1133096937 16:3453847-3453869 GTGGGAGGAGAGCAGGGACTGGG - Intronic
1133113388 16:3562978-3563000 CAGGGCAGGGGGCAGGGGCTGGG - Intronic
1133125197 16:3641841-3641863 CTGGAAGGAGAGCAGGGGCCGGG + Intronic
1133293075 16:4735366-4735388 CTGGGAATAGGGCAGGTGCTTGG - Intronic
1133974256 16:10589193-10589215 TTGGCCAGAGAGCAGGGGGCAGG + Intergenic
1134093473 16:11403867-11403889 CCGGGCAGGGAGAAGGGGCCAGG - Intronic
1135194862 16:20386150-20386172 CTGGGCAGTGGGGAGGGACTGGG + Intronic
1135719957 16:24807888-24807910 CTGGGCTGTGGGCAGAGGCTGGG + Intronic
1135746614 16:25022352-25022374 CTGGCCAGAGGGCAGGAGCTGGG + Intergenic
1135755684 16:25095837-25095859 CTGGCCAGAGTGCAGGAGCTGGG + Intergenic
1135764920 16:25169211-25169233 CAGGTCAGAGAGCAGGGACTGGG + Exonic
1136054949 16:27681487-27681509 CTGGGAATACAGCAGGAGCTTGG - Exonic
1136077045 16:27824339-27824361 CTGTGGAAAGAGCAGGGGTTTGG - Intronic
1136169127 16:28477640-28477662 GAGGGCAGAGAGCAGGGGTGAGG + Intronic
1136187670 16:28597576-28597598 GTGGGCAGAGTGAAGGGGCAGGG + Intergenic
1136190149 16:28610556-28610578 GTGGGCAGAGTGAAGGGGCAGGG + Intronic
1136266981 16:29127656-29127678 CTAAGCAAAGAGCAGGGGCAGGG + Intergenic
1136383659 16:29909542-29909564 CTTAGCACAGAGCAGGGGCTTGG + Intronic
1136485313 16:30568082-30568104 CTGGACAGAAAACACGGGCTGGG - Intergenic
1137054367 16:35736211-35736233 CCTGGGAGAGACCAGGGGCTGGG + Intergenic
1137251798 16:46746796-46746818 CGGTGCAGACAGCGGGGGCTAGG + Intronic
1137553454 16:49455785-49455807 CTTGGCAGAGAGGAGGGCATGGG - Intergenic
1137676473 16:50305986-50306008 CTGGGCGGGGGGCAGGGGCGGGG + Intronic
1137709044 16:50553931-50553953 CTGGGCAGAGTGCTGGGGAGTGG + Intronic
1138096876 16:54218789-54218811 CTGGGGAAATAGCAGGGGCCAGG + Intergenic
1138191812 16:55019237-55019259 CCAGGCAGAGGGCAGAGGCTCGG + Intergenic
1138346198 16:56321731-56321753 CTGGGCAGAGAGGAGCGGGCAGG + Intronic
1138512826 16:57518531-57518553 CTGGGAACAGGGCAGGGGCCAGG - Intronic
1138537274 16:57666763-57666785 GTGGGCAGAGGGCAGGTGCAGGG - Intergenic
1138657421 16:58499415-58499437 CTGGGCAGATAGCAGGGCCAGGG - Intronic
1139015375 16:62683832-62683854 CTGTGGAGCCAGCAGGGGCTGGG + Intergenic
1139305089 16:65978547-65978569 CTGAGCAGAGAGGTGAGGCTAGG - Intergenic
1139311517 16:66031979-66032001 CTGTGCAGAGAGCTGTGGCTGGG - Intergenic
1139465879 16:67153879-67153901 CTGGGCAGGGGACAGGGGGTAGG - Intergenic
1139734833 16:68978674-68978696 GTGGGGAGAGAGCAAGGCCTAGG - Intronic
1141159406 16:81619034-81619056 CTGGGCAGGGGGCACAGGCTTGG + Intronic
1141331797 16:83117622-83117644 CCTGGCAGAGAGAAAGGGCTTGG + Intronic
1141418817 16:83898833-83898855 CGGGAAAGAGAGGAGGGGCTGGG + Intergenic
1141441311 16:84031467-84031489 AAGGGCAGAGAGCATGGGCGGGG - Intronic
1141647796 16:85376760-85376782 CTGGGCAGAGAGCAGGGGGCTGG + Intergenic
1141674058 16:85508394-85508416 GTGGAAACAGAGCAGGGGCTAGG - Intergenic
1141848036 16:86624242-86624264 CTGTACAGAGAGCAGGTGCAAGG - Intergenic
1141919699 16:87127638-87127660 ATGGCCAGTGAGCTGGGGCTGGG - Intronic
1142042085 16:87900703-87900725 CTGGGCGGAGAGCTGCGGTTTGG + Intronic
1142067113 16:88068981-88069003 CTGGGCTGGGTGCAGGGGCAGGG - Intronic
1142070269 16:88087979-88088001 CTAAGCAAAGAGCAGGGGCACGG + Intronic
1142119577 16:88379381-88379403 CTCTGCAGGGAGCAGGGGCTGGG - Intergenic
1142215089 16:88826122-88826144 CTGGGCAGGGAACAGGGGTGGGG + Intronic
1142240953 16:88944798-88944820 CTGGCCAAAGGGCAGGCGCTAGG + Intronic
1142638161 17:1270515-1270537 GAGGGCAGAGGGCCGGGGCTGGG + Intergenic
1142856103 17:2731288-2731310 CTGGGCTGAGAAATGGGGCTTGG - Intergenic
1142891955 17:2949439-2949461 CAGGGCATAGAGCAGGCACTCGG - Intronic
1142984519 17:3687962-3687984 CTGGGCGGGGGGCGGGGGCTGGG - Intronic
1143105249 17:4526651-4526673 CTGGAAAGAAAGCAGGGACTGGG + Intronic
1143253515 17:5539371-5539393 CTGGGCAGAGGGAAGAGGGTTGG - Intronic
1143571316 17:7760391-7760413 TGGGGAAGGGAGCAGGGGCTTGG + Intronic
1143631961 17:8144711-8144733 CTGGGCAGAGGGCAGGCTCCAGG + Intronic
1143866073 17:9925156-9925178 CTGGTCAGAGATCTGGGGCTTGG + Intronic
1143895716 17:10134785-10134807 CTGGGCAGACAGTAGAAGCTCGG + Intronic
1144480174 17:15622373-15622395 CTGGCCAGCCAGCAGGGACTCGG + Intronic
1144818329 17:18052575-18052597 CCTGGCAGACACCAGGGGCTTGG + Intronic
1144825048 17:18101030-18101052 CTGGGGATAGGGCAGGGCCTTGG + Intronic
1144952394 17:19001248-19001270 CAGGGCAGAAAGCAGGGGCTTGG + Intronic
1145250989 17:21297023-21297045 GTGGGCAGAGTGCAGGAGCCAGG - Intronic
1145272333 17:21411387-21411409 GTGGGGAGAGAGCACGGGCCCGG - Intronic
1145888935 17:28401355-28401377 CTGGGCACAGAGAAAGTGCTGGG + Exonic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1146212417 17:30952866-30952888 CAGGCCACAGAGAAGGGGCTGGG - Intronic
1146370250 17:32261686-32261708 CTGCAGAGAGAGAAGGGGCTCGG + Intergenic
1146594158 17:34155274-34155296 TTGGGCAGAGAGGAGGGTCTGGG - Intronic
1146620114 17:34390653-34390675 CCTGGCAGACAGCAGGGGCTTGG - Intergenic
1146662709 17:34675257-34675279 CTGGCCCCAGAGCAGGGGCTTGG + Intergenic
1146955065 17:36932663-36932685 CTGGGCATGGGGCAGGGGCGTGG - Intergenic
1147178087 17:38669238-38669260 GTGGGCAGGGACCAGGAGCTTGG + Intergenic
1147258435 17:39195561-39195583 CTGGGGAGGGAGTAGGGGCATGG + Intronic
1147268829 17:39252349-39252371 CTCTGCAGAGAGAAGGGACTTGG + Intergenic
1147653300 17:42073985-42074007 CTGAGGGGAGAGCAGGGGCAAGG - Intergenic
1147672371 17:42184106-42184128 GTGGGCAGAGGGCAGAGGCCTGG + Exonic
1147864835 17:43545495-43545517 CTGTGGTGAGAGTAGGGGCTGGG + Intronic
1148384237 17:47222816-47222838 GTGGGCACAGAGCAGAGTCTAGG + Intronic
1148445190 17:47733357-47733379 ATGGGCAGGGAGCAGGGGGCGGG - Exonic
1148738022 17:49875733-49875755 CTGGGCTGAGAGGAGGGGAGGGG + Intergenic
1148894701 17:50833027-50833049 CGGGGCAGCCAGCATGGGCTGGG + Intergenic
1149213210 17:54326945-54326967 CAGAGCAGTGAACAGGGGCTGGG + Intergenic
1149497154 17:57126238-57126260 ATGGTAAAAGAGCAGGGGCTGGG + Intergenic
1150263929 17:63819696-63819718 CTGTGATGTGAGCAGGGGCTAGG + Exonic
1150645837 17:66976959-66976981 CTAGGCACAGAGCAGGCTCTTGG - Intronic
1150650740 17:67008464-67008486 CTGGGCAAAGAGCTGAGGCATGG + Intronic
1151263079 17:72931944-72931966 CTGTGGTGAGAGCAGGGCCTGGG - Intronic
1151299876 17:73216311-73216333 CTGGGCAGACAGCAGGTGTTTGG + Intronic
1151425889 17:74030859-74030881 CTGGGCAGAGATGGGGGCCTTGG - Intergenic
1151426195 17:74032542-74032564 GTGGGCAGGGGGCAGGGCCTGGG - Intergenic
1151475644 17:74343047-74343069 CTGGGCACAGACCAGGAGCCTGG + Exonic
1151492186 17:74439355-74439377 CAGGGCAGAGAGGAGGTACTGGG + Intronic
1151718271 17:75842568-75842590 CTGGGCATTGAGCAGGGGGTAGG - Exonic
1151969239 17:77449437-77449459 CTTGGAGGAGAGCAGGGTCTTGG + Intronic
1152083707 17:78204805-78204827 CTGCACAGAGAGCATGAGCTGGG - Intronic
1152100592 17:78299579-78299601 CTGGCAAAAGAGCAGGGGGTTGG - Intergenic
1152116697 17:78392380-78392402 CTGGGGAGTGAAGAGGGGCTGGG - Intronic
1152161523 17:78671314-78671336 GTGGGCAGAGAGGAGAGGCCAGG + Intergenic
1152318136 17:79592875-79592897 CTGGGCAGGGAGAAGGGGCAGGG - Intergenic
1152329706 17:79665393-79665415 CGGAGCAGAGAGGAGGGGCCTGG + Intergenic
1152329714 17:79665423-79665445 CGGAGCAGAGAGGAGGGGCCTGG + Intergenic
1152361719 17:79835966-79835988 CTGAGCACAGAGGTGGGGCTTGG - Intronic
1152574122 17:81132732-81132754 CTGTGCTGAGGGAAGGGGCTGGG - Intronic
1152592132 17:81218880-81218902 CAGGGCAGAGAGAAGGGGTCTGG - Intronic
1152629933 17:81406365-81406387 GTGGGCGGGGAGCGGGGGCTGGG - Intronic
1152659282 17:81534992-81535014 CTGGGTAGGGAGCAGGGGAGGGG - Intronic
1152858216 17:82678704-82678726 CGGGGCAGAGGGGAGGGGCAGGG + Intronic
1153121431 18:1732167-1732189 TTGGGCAGATAGCAAGGGCATGG + Intergenic
1153519430 18:5937965-5937987 GTGTGCAGAGAGCAGGTGCTTGG + Intergenic
1154355103 18:13619080-13619102 CCAGGCTGAGAGAAGGGGCTGGG - Intronic
1154448895 18:14459093-14459115 CTGAGCATAGTGCAGGCGCTGGG - Intergenic
1155053360 18:22166321-22166343 TTGGGCAGGGGGCGGGGGCTTGG - Intergenic
1156349376 18:36290228-36290250 CTGGGCAGGGGGCAGAGGCTGGG + Intergenic
1156354250 18:36328124-36328146 CTGGGGAGAGGGCAGTGGCCAGG + Intronic
1156454124 18:37283274-37283296 GAGAGCAGACAGCAGGGGCTTGG - Intronic
1156487854 18:37477935-37477957 CTGAGCAGAGGGCAGGGGTGGGG + Intronic
1157439131 18:47696878-47696900 CAGGGCAAAGAGGAGGGGGTGGG - Intergenic
1157582316 18:48780834-48780856 CAGGGCAGAGTGCAGGGGTAGGG + Intronic
1157591772 18:48840607-48840629 CTGGGCTGAGAAAAGGGCCTGGG - Intronic
1157895685 18:51464650-51464672 CTGGGAGGACAGCAGGAGCTTGG + Intergenic
1158410400 18:57200243-57200265 ATGGGCATAGAGCAGGCCCTCGG + Intergenic
1158649565 18:59273485-59273507 AGGGGCCGAGAGAAGGGGCTGGG - Intronic
1159297405 18:66512794-66512816 CTGGGTAGAGGGCAGGGGCTTGG + Intronic
1159637569 18:70824130-70824152 CTGTGCTGAAAGCAGGGGCCAGG + Intergenic
1160223323 18:76992798-76992820 GTGGGAGGAGAGCTGGGGCTGGG - Intronic
1160233632 18:77068067-77068089 CTGGGCAGACAGGAGGGGATGGG + Intronic
1160560141 18:79750987-79751009 CTGGGCACAGAGGACAGGCTGGG + Intronic
1160754852 19:751736-751758 CCGGGCAGCCAGCAGGGACTCGG + Intronic
1160854060 19:1208048-1208070 CTGGGAAAGGAGCAGGGCCTGGG - Intronic
1160857694 19:1224698-1224720 CTGGGAGGAGAGCAGGGGCTGGG + Intronic
1160941416 19:1622023-1622045 CAGGGCAGGGGGCAGGGGGTGGG - Intronic
1160959504 19:1713051-1713073 CTGGGCACAGAGCAGGGCCCTGG + Intergenic
1161075296 19:2282333-2282355 CTGGACAGAGACCAGGAGGTGGG + Intronic
1161200951 19:3014515-3014537 CTGGGCACAGAGCAAGGGGTGGG - Intronic
1161239015 19:3211471-3211493 CTGGGCGGCGAGCAGAGGCCAGG + Intergenic
1161251925 19:3285285-3285307 CAGGGCCGAGAGCTGGGGTTGGG - Intronic
1161334624 19:3706093-3706115 AGGGACAGAGAGGAGGGGCTGGG + Intergenic
1161335048 19:3708516-3708538 CTGGGCAGGCAGCAGGTGCCAGG - Intronic
1161721731 19:5906403-5906425 CCTGGCACAGAGCAGGTGCTCGG - Intronic
1161830718 19:6602218-6602240 TTAGGCAGAGAGCAAGGGCATGG + Intronic
1161999390 19:7733539-7733561 CTAGGCAGTGGGCAGTGGCTAGG + Intronic
1162109224 19:8390978-8391000 CTGGGCCGAGATGAGGGCCTGGG + Intronic
1162152356 19:8655458-8655480 CTGGGCAGACACCAGGTGCGGGG + Intergenic
1162345402 19:10115438-10115460 CAAGGCAGGGAGCAGGGGCTGGG + Intronic
1162384597 19:10353540-10353562 CTGGGCGAAGAGCAGCAGCTGGG + Exonic
1162410041 19:10500098-10500120 CAGGGCAGAGGGCAGGGGTTGGG + Intronic
1162446843 19:10728600-10728622 CTGGGCACCCAGCAGGGACTGGG + Intronic
1162739962 19:12768155-12768177 CAGGGCTGGGAGCAGGGGCAGGG + Intronic
1162932646 19:13964953-13964975 CTGGGCACAGGGCAGGGACTGGG - Intronic
1163444914 19:17340632-17340654 CAGGGCACAGCACAGGGGCTGGG - Intronic
1163681509 19:18684812-18684834 GTGGGCCAGGAGCAGGGGCTTGG + Intronic
1163702617 19:18793756-18793778 CTGGTCACAGTGCTGGGGCTTGG + Intergenic
1163749087 19:19064672-19064694 CAGGGCAGAGGGCAGGTGCCAGG - Intronic
1164061391 19:21678310-21678332 CAGGGGAGTGAGGAGGGGCTGGG + Intergenic
1164089914 19:21940732-21940754 CAGGGAAGTGAGGAGGGGCTGGG - Intronic
1164109330 19:22140308-22140330 CAGGGAAGTGAGGAGGGGCTGGG - Intergenic
1164421275 19:28095325-28095347 CGAGGCAGAGAGCAGAGGATAGG + Intergenic
1164557235 19:29263107-29263129 CTGGGCACAGAGCAGTGGACTGG - Intergenic
1164700063 19:30278737-30278759 CTGGAGAGAGAGCAGTGGCAGGG - Intronic
1164733765 19:30525619-30525641 ATGGGCTGAGAGCTGGGGGTTGG + Intronic
1165137501 19:33678958-33678980 CCTGGCACAGAGCAGGTGCTTGG - Intronic
1165154780 19:33780441-33780463 ATAGGCAGAGAGAAGGCGCTGGG + Intergenic
1165287014 19:34851003-34851025 CTGGGCAGGCAACGGGGGCTTGG + Intergenic
1165319278 19:35075724-35075746 CTGGGCAGTGAGGAGGGTCCTGG + Intergenic
1165723395 19:38095634-38095656 CTGGGGACAGGGCAGGGGCAGGG + Intronic
1165746237 19:38231270-38231292 CTGGGGAGAGAGCAAGGACCCGG + Intergenic
1165791028 19:38492653-38492675 CTGGGGAGAGGGCAGGGGTGGGG + Intronic
1165900571 19:39167508-39167530 TTGGGCTCAGAGAAGGGGCTGGG + Intronic
1166067753 19:40370076-40370098 AGGGGCAGAGATCAGGGGCCAGG - Intronic
1166297822 19:41897378-41897400 ATGGGGAGAGGGGAGGGGCTGGG - Intronic
1166593627 19:44025462-44025484 CTGGGCGGAGAGCAGAGGTTTGG + Exonic
1166703029 19:44893108-44893130 CCAGGCAGAGAGCAGGGGTTTGG - Intronic
1166740633 19:45112805-45112827 CGGGGCACAGAGCAGGTGCTGGG + Intronic
1166862467 19:45818209-45818231 ATGGGCAGACAGCAGAGGCCGGG - Intronic
1166895251 19:46018533-46018555 CTGGGGAGAGGGCAGGGTCAGGG - Exonic
1167086596 19:47314111-47314133 AGGGGCAGAGAGCAGAAGCTGGG - Intronic
1167148286 19:47695140-47695162 CTGAGCAGGGAGAATGGGCTGGG + Intronic
1167152337 19:47717437-47717459 CTGGGTAGAGAGAAGGGAATTGG - Intronic
1167407839 19:49325295-49325317 GTGGGGAGAGAGCAGGGAGTTGG - Intergenic
1167469435 19:49667113-49667135 ATGGGCAGAGAGCAAGGCCGAGG - Exonic
1167487717 19:49772898-49772920 CTGGGGAGTGGGCAGAGGCTAGG + Intronic
1167523118 19:49968898-49968920 CTGGGCATAGAGGGGGGTCTGGG - Intergenic
1167539309 19:50075203-50075225 CTGGCCACAGGGAAGGGGCTGGG + Intergenic
1167630398 19:50622655-50622677 CTGGCCACAGGGAAGGGGCTGGG - Intronic
1167765392 19:51479124-51479146 CTGGGCAAAGGTGAGGGGCTGGG - Intronic
1167791760 19:51687938-51687960 CTGGGGAGAGAGGAAGGGGTGGG - Intergenic
1168137362 19:54360467-54360489 CTGGGCAGAACGCAGGGTCCAGG - Intronic
1168158552 19:54492743-54492765 CTGTGCAGATGGCAGAGGCTCGG - Intergenic
1168230543 19:55027831-55027853 CTGGGCTGAGAGCGAGGGTTTGG + Exonic
1168266655 19:55227265-55227287 GTGGGCATGGGGCAGGGGCTGGG + Exonic
1168277897 19:55287145-55287167 CGGGGCTGAGGGCAGGGGCGGGG + Intronic
1202715172 1_KI270714v1_random:38383-38405 CGGGGCAAAGGGCAAGGGCTTGG - Intergenic
925300563 2:2808728-2808750 CCTGGCATGGAGCAGGGGCTTGG + Intergenic
925406175 2:3606585-3606607 CAGAGCAAGGAGCAGGGGCTGGG - Intronic
925704169 2:6668425-6668447 ATGGGCAAGGAGCAGTGGCTTGG - Intergenic
925749188 2:7072138-7072160 TTGGGCAATGAGCAGAGGCTGGG + Intergenic
925909723 2:8565851-8565873 CTGGTTAGAGAGCAAGGCCTGGG + Intergenic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
926129803 2:10295680-10295702 ATAGGCAGAGCGCAGGGGCATGG + Intergenic
926153280 2:10436149-10436171 ATTGGCAGAGAGCAGGGGCCGGG + Intergenic
926320639 2:11746556-11746578 GGGGGCAGAGGGCAGGGGCGGGG - Intronic
927418386 2:22903522-22903544 GTGGGGAGAGAGAAGAGGCTAGG - Intergenic
927704360 2:25287789-25287811 CTGGGCTGAGGGTAGGGGCAAGG + Intronic
927844481 2:26464355-26464377 CTGGGCTGAGAGAAGGGTCAGGG + Intronic
927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG + Intergenic
928096533 2:28408409-28408431 CAGGCCAGAGAGAAGGAGCTGGG - Intronic
929011117 2:37446064-37446086 GCTGGCAGAGTGCAGGGGCTGGG + Intergenic
929058573 2:37900557-37900579 GTGCCCAGAGGGCAGGGGCTTGG - Intergenic
929066634 2:37982433-37982455 CATGACAGAGGGCAGGGGCTAGG - Intronic
929535796 2:42783542-42783564 CTGGGCAGAGAAGAGGGCCCAGG - Intronic
929681677 2:43998228-43998250 GGGGGTAGAGAGCAGGGGGTAGG + Intergenic
929810771 2:45187830-45187852 ATGGGAAGAGAGAAGTGGCTTGG - Intergenic
929931509 2:46259737-46259759 CTGGGCAGGGTGCAGGGGAGAGG + Intergenic
930051475 2:47219353-47219375 CTGGGGAGAGCCAAGGGGCTGGG + Intergenic
931455762 2:62408735-62408757 CTGGGAAGAGAGAAGGAGCGAGG - Intergenic
931966987 2:67545503-67545525 CTGGCAAGAGAGCAGGTGCATGG + Intergenic
932341232 2:70963672-70963694 CTGGGCTGAGAGCAGGAAGTGGG - Intronic
932411231 2:71549190-71549212 CTGGGCAGAGGGTGGGGCCTCGG + Intronic
932490119 2:72114968-72114990 CTGGGCAGGGAGCGAGGGCTTGG - Intergenic
932613164 2:73214476-73214498 CCGGGCCGCGAGCAGGGGCAGGG - Intronic
932822801 2:74915705-74915727 CTGGGAGCAGAGCAGGTGCTGGG + Intergenic
933688546 2:85161796-85161818 CTGGCCTGAGAGCAGGAGCCAGG + Intronic
933722816 2:85409268-85409290 GGAGGCAGAGAGCAGGGGCTAGG + Intronic
933976751 2:87518298-87518320 CTGCGCAGAAAGTAGAGGCTTGG + Intergenic
934563930 2:95328056-95328078 AGGGGAAGAGAGCAGGGGCAAGG + Intronic
935531624 2:104239618-104239640 CAGGGCAAAGAGCAGGGTATAGG + Intergenic
936656961 2:114499586-114499608 CTGGGTTAAGAGCAGGGACTGGG + Intronic
937469975 2:122166327-122166349 CGGGATAGAGAGCAGGGGCAGGG - Intergenic
937928714 2:127188212-127188234 CTGGACAGAGAGGAAGGGCAGGG - Intronic
938092064 2:128440707-128440729 CTTGGCATTGAGCAGGGGCGGGG + Intergenic
938482578 2:131673763-131673785 CTGAGCACAGTGCAGGCGCTGGG + Intergenic
938491489 2:131763521-131763543 CTAGGCAGACACCTGGGGCTTGG + Intronic
938954257 2:136283495-136283517 CTGTGGACAAAGCAGGGGCTGGG - Intergenic
941846572 2:170140314-170140336 CTGAACATGGAGCAGGGGCTGGG - Intergenic
944614611 2:201447789-201447811 CTGGGCAGAGAAAAGGGGAAGGG - Intronic
946116195 2:217464541-217464563 CTGGGCAGGGGTCAGGAGCTGGG + Intronic
946312064 2:218887544-218887566 ATGAGCAGAGAAGAGGGGCTGGG - Intronic
946371859 2:219285964-219285986 CTGGGGAGAGAGCAGGGGCGGGG - Exonic
946635477 2:221720547-221720569 CTAGGCAGAGGGCAGGAGCAAGG + Intergenic
947533668 2:230927964-230927986 CTGGTCAGGGAACAGGGGCAGGG + Intronic
947626533 2:231622668-231622690 CTGGGCCTGGAGCTGGGGCTGGG - Intergenic
947834614 2:233166448-233166470 GTGGGCAGAGAGCAGAGGTCAGG + Intronic
947864206 2:233384866-233384888 CAGGCCAGGGAGGAGGGGCTGGG - Intronic
947984609 2:234437720-234437742 CTGTGCAGGGAGCAAGGGCTGGG - Intergenic
948170199 2:235895313-235895335 CTGGGGCAAGAGCAGGGGCACGG - Intronic
948220959 2:236269525-236269547 CTGGGCACAGAGCAGGAGCCAGG - Intergenic
948279709 2:236737781-236737803 CTTGGCACAGAGCAGCTGCTGGG + Intergenic
948301336 2:236909485-236909507 CTGGAGAGAGAGCAGGGCATCGG + Intergenic
948453267 2:238091913-238091935 CTTCCCCGAGAGCAGGGGCTTGG + Intronic
948459769 2:238123537-238123559 CTGTCCACAGAGCAGGGGCCGGG - Intronic
948627245 2:239276715-239276737 CTGGGCAGCGAGCAGTGTCCAGG - Intronic
948702633 2:239769808-239769830 AGGGGCAGAGTGCAGGGTCTCGG + Intronic
948705902 2:239792355-239792377 CTGGGAAGGCAGAAGGGGCTGGG - Intronic
948735913 2:240004731-240004753 GTGAGCAGAGGGCAGGGGCTTGG - Intronic
948901068 2:240957166-240957188 GAGGGCAGAGAGCTGGGGGTTGG - Intronic
948904049 2:240969398-240969420 GGGGGCAGAGAGCAGAGGCCAGG + Intronic
948908556 2:240991638-240991660 TCCGGCAGAGAGCAGGGGCTTGG + Intronic
948974680 2:241457060-241457082 CTGAGCAGAGAGGAGGTACTGGG + Intronic
1169066718 20:2698069-2698091 GTGGGCAGAGAGCAGTGGAGTGG + Intronic
1170075831 20:12417735-12417757 CAGTGCAGACAGCAGGGGCTGGG - Intergenic
1170327277 20:15170882-15170904 CTGGGCAGCCAGCAGTGGGTTGG - Intronic
1170645158 20:18191230-18191252 CCAGGCAAAGAGAAGGGGCTGGG - Intergenic
1170688109 20:18587713-18587735 CTGGGCACTGGGTAGGGGCTGGG + Intronic
1172676602 20:36677092-36677114 CCGGGAAGCGAGCAGGAGCTGGG + Intronic
1172814367 20:37674518-37674540 CTTGGCACAGAGTAGGTGCTCGG - Intergenic
1173107552 20:40152024-40152046 CAGGACATGGAGCAGGGGCTGGG - Intergenic
1173163468 20:40669814-40669836 CTGGGCACAGAGGAGGCTCTAGG + Intergenic
1173267754 20:41501070-41501092 GTGGGCAGTGAACAGGTGCTAGG + Intronic
1173595447 20:44256078-44256100 CAGGGCAGAGAGCACTGGTTTGG + Intronic
1173665159 20:44757861-44757883 CTGGGCTGGGAGCAGGGGAAGGG - Intronic
1173906288 20:46632044-46632066 CTGGGCAGTGACCAGGCTCTTGG + Intronic
1174377878 20:50138557-50138579 CTGGGCAGCGTGCAGGCGCCAGG - Intronic
1174407199 20:50310171-50310193 CTGAGCAAAGGGCAGGGGCGGGG - Intergenic
1174421808 20:50404132-50404154 GTGGGCAGAGAGCAAGGTCGGGG - Intergenic
1174741033 20:53014552-53014574 CAGGGCAGAGAGCACTGCCTAGG - Intronic
1175130137 20:56782590-56782612 CAGGGCAGAGACCAGGGACGGGG - Intergenic
1175305042 20:57970076-57970098 CTGTGGAGAGAGCAGTGGATGGG + Intergenic
1175357630 20:58381372-58381394 CTGGCCAGATAGCAAGGGGTTGG + Intergenic
1175381484 20:58567282-58567304 CTGGCCAGAGCACAGGTGCTGGG + Intergenic
1175412203 20:58777739-58777761 CAGGGCAGGCAGCAGGGGCCAGG - Intergenic
1175697700 20:61114900-61114922 GTGGGCAGAGGGCAGGGGTCAGG + Intergenic
1175899440 20:62354261-62354283 CTGTGCGGAGAGAAGGGCCTGGG - Intronic
1176064465 20:63187511-63187533 CGGGAGAGAGAGCAGAGGCTGGG - Intergenic
1176086243 20:63296839-63296861 CGGGGGGAAGAGCAGGGGCTGGG - Intronic
1176115502 20:63430241-63430263 CCTGGGAGAGAGCAGAGGCTGGG + Intronic
1176195781 20:63835899-63835921 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195795 20:63835937-63835959 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195809 20:63835975-63835997 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195823 20:63836013-63836035 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195847 20:63836078-63836100 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195876 20:63836160-63836182 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195890 20:63836198-63836220 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176195950 20:63836362-63836384 CAGGGGAGAGGGCAGGGGCAGGG + Intergenic
1176243185 20:64084361-64084383 CTGGGCAAAGCTCAGAGGCTGGG - Intronic
1176369071 21:6051808-6051830 CGGGGCAGAGAGTGGGGGCTGGG - Intergenic
1176447324 21:6831434-6831456 CTGAGCACAGTGCAGGTGCTGGG + Intergenic
1176708602 21:10132371-10132393 CTAGGCAGACACCTGGGGCTTGG + Intergenic
1176825492 21:13696460-13696482 CTGAGCACAGTGCAGGTGCTGGG + Intergenic
1178635163 21:34296141-34296163 CTGGGCATACAGCAGGTGGTAGG + Intergenic
1178756465 21:35354702-35354724 GCAGGCAGTGAGCAGGGGCTAGG + Intronic
1178919098 21:36726861-36726883 CTGGGCTGGGAGGAGGGGATTGG + Intronic
1179411581 21:41167468-41167490 CTGGACTGAGGGCGGGGGCTCGG + Intergenic
1179586605 21:42377390-42377412 GTGGGCAGAGTGCAGACGCTGGG + Intronic
1179612310 21:42560260-42560282 GAGGGCTGAGAGCAGGGGCGTGG + Intronic
1179647929 21:42786466-42786488 CTCTGCAGAGAGCAGGAACTGGG + Intergenic
1179710086 21:43208219-43208241 CTGGGGTCAGAGAAGGGGCTGGG + Intergenic
1179754448 21:43486733-43486755 CGGGGCAGAGAGTGGGGGCTGGG + Intergenic
1179790888 21:43755399-43755421 CTTGGCAGGCAGCAGGAGCTTGG - Intronic
1179792759 21:43764901-43764923 CAGGGCAGTGCGCAGGGGCCTGG - Intergenic
1179937781 21:44616080-44616102 CTGGGCAGAGTGCAGCGTGTCGG + Intronic
1179951563 21:44711503-44711525 CAGGGCAGACATGAGGGGCTTGG + Exonic
1180185282 21:46136315-46136337 CTGGGCAGGGAGCTGAGGCAGGG + Exonic
1180238729 21:46483463-46483485 CTGTGCAGAGGGCAGGGCTTGGG + Intronic
1180882863 22:19218839-19218861 CTGGGCAGAGTGCTGGGGCCAGG - Intronic
1181439260 22:22927396-22927418 CTGGGCTGAGGGCTGGGGCCGGG - Intergenic
1181688181 22:24543460-24543482 ATGGGTCTAGAGCAGGGGCTGGG + Intronic
1181728245 22:24826531-24826553 CTGGCCACACAGCAGGTGCTCGG - Intronic
1182148816 22:28014278-28014300 CAGGGCACGGAGCGGGGGCTTGG + Exonic
1182299056 22:29328011-29328033 CTGGGCCGAGAGATGGGGCTGGG - Exonic
1182355669 22:29721286-29721308 CAGAGCAGAGGGCAGGGGCAGGG + Intronic
1182554787 22:31123234-31123256 CTGCTCAGCGAGCAGGGGCTAGG + Intronic
1182829017 22:33289853-33289875 GTGAGCTGAGAGGAGGGGCTCGG - Intronic
1183361306 22:37384681-37384703 GTGGGGAGAGGGCAGGGGTTGGG - Intronic
1183361322 22:37384722-37384744 GTGGGGAGAGGGCAGGGGTTGGG - Intronic
1183522590 22:38303990-38304012 CCAGGCAGAGAGCGGGGCCTTGG - Intronic
1183686755 22:39365466-39365488 CTGGGCACACAGCAGGCCCTGGG + Intronic
1184003675 22:41693623-41693645 CTGTGGAGAGAGCAGGTTCTGGG - Exonic
1184037581 22:41926051-41926073 CTGAGCGGGGCGCAGGGGCTGGG - Intronic
1184078877 22:42203738-42203760 CTTGCCAGAGAGAGGGGGCTGGG + Intronic
1184148980 22:42627689-42627711 CTGGGGAGAGAGAAGGGGTGAGG + Intronic
1184149602 22:42630573-42630595 CTTGGCAGAGAACAGGGGCCAGG - Intronic
1184150689 22:42636647-42636669 CTGAGCACAGAGTAGGTGCTGGG + Intronic
1184192618 22:42904869-42904891 CTGGGCACAGTGCAGGGGGGCGG - Intronic
1184240676 22:43209928-43209950 CAGGGCAGAGAGGAGGGCCCTGG - Intronic
1184275123 22:43405562-43405584 GTGGGCAGAGATCTGGGTCTGGG + Intergenic
1184279216 22:43427471-43427493 CTGGGCAGGCAGCAGGGGTTGGG + Intronic
1184334941 22:43847581-43847603 CTGGCCAGAGAAGAGGGGGTGGG - Intronic
1184363008 22:44030191-44030213 CTGGGCTGGGAGCTGGGGGTGGG + Intronic
1184413502 22:44338990-44339012 CAGGCCAGAGAGGAGGAGCTGGG - Intergenic
1184464630 22:44661415-44661437 CTGGGCTGGGAGCAGAGGGTGGG + Intergenic
1184468933 22:44684668-44684690 CTGGGCAGAGAGCTGGGGGCGGG - Intronic
1184602836 22:45553650-45553672 CTGGACAAAGAGCAGGGCCTGGG - Intronic
1184684905 22:46091853-46091875 CTGACCAGTGAGCAGGGCCTGGG + Intronic
1184780963 22:46649225-46649247 CTCAGCAGGGAGCAGGTGCTTGG + Intronic
1184793879 22:46719853-46719875 CTGGCCAGTGAGCAGGGGGCTGG + Intronic
1185100696 22:48839391-48839413 GAGGGCACAGAGCAGGCGCTGGG + Intronic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
1185139033 22:49089992-49090014 CTCAGCAGAGAGCAGGGGCTTGG + Intergenic
1185182310 22:49370362-49370384 CTGGGCACAGAGCAGAGACAGGG + Intergenic
1185219234 22:49621023-49621045 CTGAACAGGGAGCAGGTGCTGGG - Intronic
1185243979 22:49763603-49763625 CTGGTCAGCGAGGAGGGCCTGGG + Intergenic
950126898 3:10515085-10515107 CAGAGCATAGAGCAGGGGCTTGG + Intronic
950289330 3:11770957-11770979 CTGGGCAGAGAGGAGGGAACTGG - Intergenic
950460836 3:13121416-13121438 CTGGGCACAGAACAGCGGCTCGG + Intergenic
950463968 3:13142382-13142404 CTGGGCAGTGGGCATGGCCTGGG - Intergenic
950574630 3:13824640-13824662 CTGCGGAGAGAGCATGGGCCTGG - Intronic
950709699 3:14805457-14805479 GTGGTCAGAGAGAAGGGCCTGGG - Intergenic
950869260 3:16214569-16214591 CCTGGCACAGAGCAGGTGCTTGG - Intronic
950993188 3:17463787-17463809 GAGGGCAGAGATCAGTGGCTGGG - Intronic
952838528 3:37625126-37625148 TCAGGCAGAGAGCAGGGGCAAGG - Intronic
952858643 3:37793976-37793998 CTGGGCAGAGAACCGAGTCTTGG + Intronic
952881913 3:37990836-37990858 CTGGGCAGAGAGTTGGGGGGCGG + Intronic
952963701 3:38608338-38608360 CCAGGCAGAGGGCAGGGGCAGGG - Intronic
953389404 3:42525864-42525886 CTGGGTGGAGGGCAGGGGCAAGG - Intronic
953914532 3:46909855-46909877 CTGGTCTGAGGGAAGGGGCTTGG + Intergenic
953995186 3:47513928-47513950 CTGGGCAGAGAGCGAGGCCAAGG - Intergenic
954290800 3:49649004-49649026 CTGGGCAGGTGGCAGGGCCTTGG - Intronic
954379840 3:50213548-50213570 GTGGGCTGAGAGCTGGCGCTGGG - Intronic
954416528 3:50396027-50396049 CTGGGGAGAGAGGAGGGTGTGGG - Intronic
954537510 3:51372343-51372365 CAGGGCAGAGGGCAGGGGGAGGG + Intronic
954538605 3:51379500-51379522 ATGGGCAGACAGGAAGGGCTGGG - Intronic
954633900 3:52061212-52061234 CTGGTGAGAGTGCAGGGCCTGGG + Intergenic
954647056 3:52138011-52138033 CTGGGCAGATTGCTGGGCCTGGG - Intronic
954675260 3:52311994-52312016 CTGGGGAGGGAGCTTGGGCTGGG - Intergenic
954701331 3:52452384-52452406 CAGGCCAGAGACCAGAGGCTTGG - Intronic
954796334 3:53163004-53163026 CTGTGGAGTGAGCTGGGGCTTGG + Intronic
955756822 3:62233352-62233374 CTGGGGAGAGAGCATGGGGAAGG - Intronic
956661870 3:71606864-71606886 CGGAGCAGGGAGCAGGGGCAGGG + Intergenic
956664898 3:71632800-71632822 CTGGGCTAGGATCAGGGGCTTGG + Intergenic
956669288 3:71671332-71671354 CTGCAGAGAGACCAGGGGCTTGG + Intergenic
957050666 3:75409565-75409587 CTGGGCAGTGACCAGTGTCTTGG + Intergenic
957256881 3:77848361-77848383 CTGGGAAGAGTGGTGGGGCTGGG - Intergenic
959521001 3:107322863-107322885 GTGGGGAGAGAGCAGGGTTTTGG - Intergenic
961026544 3:123563336-123563358 CCAGGCAGAGAGCAGAGCCTGGG + Intronic
961344661 3:126256264-126256286 GTGAACAGAGAGCAGGAGCTGGG - Intergenic
961366901 3:126406105-126406127 CTGGGGAGAACTCAGGGGCTCGG - Intronic
961413999 3:126744199-126744221 CTGGGGAGAGGGGAGGGTCTTGG + Intronic
961517406 3:127446531-127446553 ATGGGGAGAGGTCAGGGGCTTGG + Intergenic
961522155 3:127473128-127473150 TTGAGCAGAGAGCAGGGCCCAGG + Intergenic
961626850 3:128269951-128269973 GGGGAAAGAGAGCAGGGGCTGGG + Intronic
961828960 3:129613484-129613506 CTTTGCTGACAGCAGGGGCTGGG + Intergenic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
961882971 3:130075997-130076019 CTGGGCAGTGACCAGTGTCTTGG + Intergenic
962626696 3:137232395-137232417 CTTGGCAGAGAGCAGGGAACAGG + Intergenic
962884501 3:139611687-139611709 CTGGGCAGTGAGCCAGGGCTGGG + Intronic
964168646 3:153739619-153739641 CTGGGCAGAGGGCAGGAACTTGG - Intergenic
964340663 3:155705522-155705544 CTGGGGAGAGGGCAGAGGTTGGG - Intronic
964541331 3:157783018-157783040 CTGTGCAGAGTGGAGGGGGTGGG - Intergenic
964768098 3:160197909-160197931 CAGGGCCCAGGGCAGGGGCTTGG - Intergenic
964979697 3:162664635-162664657 ATGGGCAGAGAGCTAGGGATGGG + Intergenic
965672353 3:171159573-171159595 CTGTGCAGAGGGGAGGGACTTGG + Intronic
966217420 3:177517970-177517992 ATGGGGAGAGAGAAGGGCCTGGG + Intergenic
966246404 3:177812814-177812836 CTGGGCAGGGAGGAGGAGCCAGG + Intergenic
966883619 3:184362775-184362797 AGGGGAAGAGAGCAGGGCCTGGG + Intronic
967808184 3:193733343-193733365 CTGGGTAGGGAGCAGGTGCAGGG + Intergenic
967853610 3:194100193-194100215 CGGTCCAGAGAGAAGGGGCTGGG + Intergenic
967887503 3:194343070-194343092 CTGTGCAAAGAGCAGGTGCCAGG - Intronic
968364011 3:198171498-198171520 CTGGGCAGAAAGCGGGGCTTCGG - Intergenic
968441129 4:625122-625144 CTGTGCAGGGAGAGGGGGCTGGG - Intergenic
968594259 4:1474210-1474232 CTGGCCTGAGTGCAGGAGCTTGG + Intergenic
968615473 4:1575736-1575758 CTTGCCAGAGAGCAGGAGCTGGG + Intergenic
968616665 4:1580604-1580626 CTGGGCAGGAGGCAGGGCCTAGG - Intergenic
968759251 4:2433577-2433599 CTGGGCATGGAGAGGGGGCTCGG - Intronic
969228597 4:5814765-5814787 CTGGGCAGAGGGCTGGGGAGGGG - Intronic
969247107 4:5942292-5942314 CTGGGCACAGTCCAAGGGCTTGG + Intronic
969265340 4:6060833-6060855 TTGGTCAGAGAGCTGGGCCTGGG - Intronic
969338815 4:6527846-6527868 CTGGACAGAAGGCAGGGCCTGGG + Intronic
969351760 4:6602169-6602191 CTGGGCACAGTGCAAGGCCTGGG - Intronic
969511369 4:7619929-7619951 CTGGGGACAGGGCAGGGGCAGGG - Intronic
969520708 4:7676264-7676286 GAGGGCAGAGGGCAGGGGGTCGG - Intronic
969549740 4:7856824-7856846 CTGGGCAGATTGCAGATGCTGGG - Intronic
969659038 4:8515648-8515670 CGGGGCAGGGAGCAGAGGCTGGG + Intergenic
969821765 4:9726090-9726112 CTGGGCAGTGACCAGTGTCTTGG - Intergenic
971664707 4:29467454-29467476 CAGGGCAGACAGGAGGAGCTGGG + Intergenic
972094142 4:35327411-35327433 CTGGTAAGAAAGTAGGGGCTGGG + Intergenic
975732010 4:77346641-77346663 CTGGGCATAGAGCAGGGCAAAGG + Intronic
975928783 4:79492376-79492398 CTGGGCAGAGTCCAGGGGGTTGG - Intergenic
978514893 4:109559726-109559748 CTCGCCAGCGAGCAGGGGCCCGG + Intergenic
981405945 4:144369255-144369277 ATGGTCAGGGAGTAGGGGCTTGG + Intergenic
981548496 4:145918707-145918729 CTGGGGTGAGAGCTGGGGGTGGG - Intronic
981750639 4:148090142-148090164 CCTGGCACAGAGCAGGTGCTCGG - Intronic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
985163420 4:187067765-187067787 CAGGCCAGAGTGCAGTGGCTCGG + Intergenic
985606728 5:861969-861991 CGGTGGAGGGAGCAGGGGCTGGG - Intronic
985664827 5:1176684-1176706 CTGGGGCCAGAGCCGGGGCTGGG - Intergenic
985761674 5:1752160-1752182 GTCGGCACAGAGCAGGGGCAGGG - Intergenic
985841086 5:2306525-2306547 CTGGGCAAAGAAGGGGGGCTGGG - Intergenic
986705750 5:10453332-10453354 CTGGGTAGACAGGAGGTGCTCGG + Intronic
987019051 5:13851350-13851372 CAGGCCAGAGTGCAGGTGCTCGG + Intronic
987476662 5:18399795-18399817 CCGGGCAGGGGGCAGGGCCTGGG - Intergenic
988773373 5:34453420-34453442 CTGGCCAGAAAGCAAAGGCTGGG - Intergenic
989809233 5:45652808-45652830 CTGGGCAGAGAGAAGAGTCAGGG - Intronic
990320387 5:54624311-54624333 ATGGGCAGTTAGCAGGGGTTTGG + Intergenic
992178738 5:74176011-74176033 CTGAGCAGAGAGCAGGAGAGCGG - Intergenic
992752135 5:79871472-79871494 TTCAGCAGAGAGCAGGGGCTAGG + Intergenic
994355247 5:98787364-98787386 CTAGGCCCAGAGCAGGGCCTCGG + Intronic
995221381 5:109652604-109652626 TTGGACAGAGAGCAGGGGCTGGG - Intergenic
995748208 5:115426138-115426160 CTAGGGAGGAAGCAGGGGCTGGG - Intergenic
996722953 5:126647852-126647874 CTGGGAAGAAAGTAGGAGCTAGG + Intergenic
997756959 5:136408463-136408485 CTGGGCAGAGAGGGAGGACTGGG + Intergenic
998402595 5:141855776-141855798 CTGGGCAGGGAGCTGGGGCAAGG - Intronic
999201885 5:149822492-149822514 ATGGGCAGGGAGCAGGGGCTGGG - Intronic
999231682 5:150065546-150065568 CTGGGCAATGAGGAGAGGCTGGG + Intronic
999254707 5:150203884-150203906 CTGAGGAGAGAGGAGGGGCTGGG - Intronic
999375983 5:151086884-151086906 CTGGGTGAGGAGCAGGGGCTGGG + Intronic
999396187 5:151230014-151230036 CTGGGCAGAGGACATGTGCTTGG - Intronic
999799464 5:155019711-155019733 CTGGTCTCAGAGCAGGGGTTGGG - Intergenic
999829370 5:155304181-155304203 TTGGTCAGAGGACAGGGGCTGGG + Intergenic
1000018758 5:157301067-157301089 CAGGGCATAGAGCTGGGCCTTGG + Intronic
1001073325 5:168605543-168605565 CTGGGGTGAGAGAAGGGGATAGG + Intergenic
1001254355 5:170172056-170172078 CTGGGAGCAGAGCAGGGCCTTGG + Intergenic
1001330062 5:170755468-170755490 CTGGGCACATAGCAGGTACTTGG + Intergenic
1002021851 5:176368675-176368697 GTGGGCAGTGAGCGGGGGCCCGG + Intronic
1002021869 5:176368713-176368735 GTGGGCAGTGAGCGGGGGCCCGG + Intronic
1002021887 5:176368751-176368773 GTGGGCAGTGAGCGGGGGCCCGG + Intronic
1002025307 5:176392736-176392758 ATGGCCACAGAGCATGGGCTGGG - Exonic
1002193156 5:177489325-177489347 GTGGGCAGACAGGTGGGGCTGGG + Intronic
1002581725 5:180212800-180212822 CTGGGCAGGGGGCAGGGAATGGG + Intergenic
1002634311 5:180599542-180599564 CTGGGCAGAGAGCCTGGGACAGG - Intergenic
1002778561 6:349110-349132 GTGGGCGGAGTGCAGGGGCCTGG - Exonic
1002819384 6:710860-710882 GTGGGTAGAGAGCAGGGACGAGG + Intergenic
1003135983 6:3435105-3435127 AGGGGCAGTGTGCAGGGGCTGGG + Intronic
1003161175 6:3635938-3635960 CAGGGCAGAGGGCAGGGTCAGGG + Intergenic
1003507599 6:6752431-6752453 CTTCCCAGAGAGCAGGGGCTGGG + Intergenic
1004900830 6:20192419-20192441 CTGGGCAGTGAGGAGGGTGTGGG - Intronic
1005367872 6:25097678-25097700 CTGGGTGGAGAGCTGGGGCTGGG - Intergenic
1005822208 6:29607303-29607325 GTGGGCAGGGAGCACGGGCAGGG + Intronic
1006063514 6:31443007-31443029 GTTGGCAGAGAGCAGGGCCTGGG - Intergenic
1006137111 6:31901926-31901948 CTGGGCAGCGCGCAGGCGCGGGG + Exonic
1006160663 6:32038999-32039021 GTGGGGAGAAAGCAGGGGTTGGG + Intronic
1006190128 6:32202374-32202396 CTGCTCAGAGACCACGGGCTTGG - Exonic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006301076 6:33193746-33193768 CTGGGCACATAGCATAGGCTGGG - Exonic
1006374673 6:33665310-33665332 CTGGGGAGAGAGTAGGGGACTGG + Intronic
1006436012 6:34026564-34026586 CTGGGCAGGAAGCAGGGGCCTGG + Intronic
1006448038 6:34090878-34090900 CTTGGGAGAGACCAGGGGCAGGG + Intronic
1006640372 6:35486405-35486427 GAGGGCAGAGAGCAGGGGGAAGG + Intronic
1006801058 6:36759847-36759869 ATGGGCAGAGGGAAGGGGCAGGG + Intronic
1007154971 6:39733853-39733875 CTGAGCAGTGAGCAAAGGCTTGG - Intergenic
1007598347 6:43065816-43065838 CTGGAGACAGGGCAGGGGCTGGG + Intronic
1007610738 6:43147259-43147281 CTGGGCACAGAGCCCTGGCTGGG + Intronic
1007776794 6:44228499-44228521 CTGGCCAGAGTGCAGGAGCCTGG - Intronic
1008504052 6:52211887-52211909 GTGGGTAGGGGGCAGGGGCTTGG - Intergenic
1008543361 6:52564743-52564765 CTTGGCAGAGAGCAAATGCTTGG + Intronic
1009957287 6:70471173-70471195 TTGGGCAGAGAGCTGGAGTTGGG + Intronic
1010466525 6:76173298-76173320 CTGCTCAGAGAGCAGTGGTTAGG + Intergenic
1011649430 6:89492180-89492202 CTGGAGAGAGCGCCGGGGCTGGG + Intronic
1013032045 6:106343090-106343112 GTAGGGAGAGAGGAGGGGCTGGG + Intergenic
1013661907 6:112306630-112306652 CTGGGCACAGAGCAGGTGCTCGG + Intergenic
1014705364 6:124739924-124739946 CTGGGCAGAGAGCAAAGCATGGG + Intronic
1015003764 6:128253045-128253067 CTCAGAAGAGAGCAGGGGTTTGG - Intronic
1015116443 6:129654762-129654784 CTGGGCAGAGAGGAGGATCCAGG - Intronic
1015960005 6:138638754-138638776 CTGGGAAGACAGCAGAGGGTTGG - Intronic
1016013735 6:139163783-139163805 GTGGGCAGAGACCAGAGGCCAGG - Intronic
1016773224 6:147875552-147875574 CAGGCCACAGACCAGGGGCTGGG - Intergenic
1017454946 6:154593261-154593283 CTGGGGAGAGAGCTGGGGGAGGG - Intergenic
1017592603 6:155993437-155993459 CTGGGCAGTCAAGAGGGGCTGGG + Intergenic
1017676538 6:156820113-156820135 CTGTGCAGAGTTCTGGGGCTTGG + Intronic
1017706995 6:157132617-157132639 TTGGGCAGGGAGCAAAGGCTTGG + Intronic
1018205800 6:161436174-161436196 GAGGGCAGAGAGCAGGGGGCAGG + Intronic
1018205808 6:161436201-161436223 GAGGGCAGAGAGCAGAGGGTGGG + Intronic
1018205822 6:161436255-161436277 GAGGGCAGAGAGCAGGGGAGTGG + Intronic
1018205831 6:161436284-161436306 AGGGACAGAGAGCAGGGGCCGGG + Intronic
1018956831 6:168415905-168415927 CTGGGCAGTGACCATGCGCTGGG + Intergenic
1019209963 6:170397154-170397176 TTGGGAAGAGTGCAGGGTCTGGG + Intronic
1019279101 7:191469-191491 GTGGGCCGGGAGCAGGGCCTGGG - Intergenic
1019404764 7:877527-877549 CTGGGGAGAGAGCCGGGGTTGGG - Intronic
1019500175 7:1360728-1360750 AAGGGCAGAGAGCTGGGGCCAGG + Intergenic
1019501127 7:1365235-1365257 CTGGGAAGGGAGCAGAGGCTTGG - Intergenic
1019637296 7:2082786-2082808 CTGGGCCGAGTGCAGGCGCCGGG - Intronic
1019641486 7:2106022-2106044 CTGGGCAGAATGGAGGGGCGGGG - Intronic
1019641506 7:2106101-2106123 CTGGGCAGGGTGGAGGGGCGGGG - Intronic
1019798104 7:3067023-3067045 GGAGGCTGAGAGCAGGGGCTTGG - Intergenic
1019803436 7:3105254-3105276 CTGGGGCCAGAGAAGGGGCTTGG - Intergenic
1019879542 7:3846498-3846520 GTGTGCAGGGAGCAGGGCCTTGG - Intronic
1019923940 7:4180176-4180198 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923946 7:4180201-4180223 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923951 7:4180226-4180248 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923957 7:4180251-4180273 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923968 7:4180301-4180323 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923973 7:4180326-4180348 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923979 7:4180351-4180373 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923985 7:4180376-4180398 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923990 7:4180401-4180423 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923994 7:4180426-4180448 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019924006 7:4180476-4180498 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019924015 7:4180526-4180548 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1020085672 7:5308955-5308977 TGGGGGAGAGAGGAGGGGCTTGG + Intronic
1020129288 7:5550483-5550505 CAGGGCAGAGAGAAAGGGGTAGG - Intronic
1020316987 7:6912737-6912759 CTGGGCAGTGACCAGTGTCTTGG + Intergenic
1020334856 7:7055258-7055280 CTGGGAAGAGAGCTGAGGCAGGG - Intergenic
1020455742 7:8372078-8372100 CTGGGCAGAATCCAGGGGCAGGG - Intergenic
1020634330 7:10678078-10678100 CTAGGCAGACAGGAGGTGCTTGG - Intergenic
1022503823 7:30898418-30898440 CAGGGAAGAGAGCGGGGACTTGG - Intergenic
1022522095 7:31015029-31015051 CTGGGCACAGATCCAGGGCTGGG + Intergenic
1022649585 7:32262330-32262352 CTGGTGAGTGAGCAGGTGCTGGG + Intronic
1023562634 7:41491658-41491680 CTGGGGAGACAGCAGTGGGTAGG - Intergenic
1023967014 7:44967975-44967997 CTGGTGAGGGAGCAGGGGCGGGG + Intronic
1024176707 7:46847685-46847707 CTGGTCAGACTGCAGTGGCTAGG - Intergenic
1024565551 7:50676995-50677017 CAGGGGAGAGGGCAGGGGCTGGG + Intronic
1024576301 7:50767457-50767479 GTGGCCAGAGAGCATGGTCTTGG - Intronic
1024602252 7:50994265-50994287 GTGGGAAGAGACCGGGGGCTGGG - Intergenic
1025208638 7:57008209-57008231 TGGGGGAGAGAGGAGGGGCTTGG - Intergenic
1025663309 7:63568669-63568691 TGGGGGAGAGAGGAGGGGCTTGG + Intergenic
1026139961 7:67697516-67697538 CAGGGCAGCGAGCAGGGGTTAGG + Intergenic
1026383246 7:69820236-69820258 CTGGGCAGAGAGTAAGTGTTGGG - Intronic
1026775335 7:73227522-73227544 CAGGGAATGGAGCAGGGGCTGGG + Intergenic
1026827944 7:73595768-73595790 CAGGGCAGGGGTCAGGGGCTGGG + Intronic
1026879625 7:73900421-73900443 CTGGGCAGAGGCCAGGGGCGTGG - Intergenic
1027016192 7:74780893-74780915 CAGGGAATGGAGCAGGGGCTGGG + Intronic
1027071836 7:75165044-75165066 CAGGGAATGGAGCAGGGGCTGGG - Intergenic
1028892944 7:96009308-96009330 CAGGGCAGAGGGCAAGGCCTTGG - Intronic
1029095557 7:98082509-98082531 CTGGCCAGAGAGCTGGGGTCCGG - Intergenic
1029604257 7:101589159-101589181 CTGGAGAGAGAGCATGGGCTGGG + Intergenic
1029710677 7:102297707-102297729 CTGGGCATACAGCAGGCGCTTGG - Intronic
1029728970 7:102426829-102426851 CTGGGGAGGGTGCTGGGGCTTGG + Intergenic
1029898986 7:104020195-104020217 CTGGGAAGAGAGCAGTGGATAGG + Intergenic
1030937962 7:115609567-115609589 CTGGGCAGTGACCAGGGGATGGG - Intergenic
1031033902 7:116766351-116766373 CAGGGCAGGGAGCGGGGACTTGG + Intronic
1031414920 7:121484248-121484270 CTGGGCAGGCAGCATGGGTTTGG + Intergenic
1031978460 7:128108305-128108327 CAGGGCAGAGAGCAGGGTGGAGG + Intergenic
1032017439 7:128389026-128389048 CTGGACAGAGGGCAGCGGCCAGG - Intergenic
1032179236 7:129661156-129661178 CTGGGCACAGCCTAGGGGCTTGG - Intronic
1032323618 7:130906125-130906147 CTGGGGAAAGAGCAGGCCCTAGG - Intergenic
1032348675 7:131140116-131140138 TTTGGCAGAGAGCAGGGTCCGGG - Intronic
1032914332 7:136471650-136471672 ATAGGTAGAGAGCAGGGGGTGGG - Intergenic
1033163167 7:139015265-139015287 CTGGTGACAGAGCAGGGGCTGGG + Intergenic
1033367719 7:140684205-140684227 CAGGGCAGAGAGGAGTGTCTGGG + Intronic
1034446806 7:151117868-151117890 CTGGGAAAAGAGTAGGGGCTTGG - Intronic
1034515300 7:151572371-151572393 GTGGGCAGCGAGGTGGGGCTTGG + Intronic
1034529543 7:151687181-151687203 CAGGGCAGACAGCAGAGGCTGGG - Intronic
1034621672 7:152461880-152461902 CAGGGAAGAGAGGAGAGGCTGGG + Intergenic
1034720266 7:153285651-153285673 CTGGGCATGGAACAGGGGCTGGG - Intergenic
1035024522 7:155817191-155817213 CTGGGGAGCGTCCAGGGGCTGGG - Intergenic
1035297298 7:157874375-157874397 GGGGGCAGAAAGCAGGAGCTGGG - Intronic
1035417821 7:158704675-158704697 TTGGGTTCAGAGCAGGGGCTGGG - Intronic
1035579464 8:731084-731106 CTGAGCCGAGAGCCGGGTCTGGG + Intronic
1035717500 8:1764665-1764687 CGGGGGAGAGAGCGGGCGCTGGG + Intronic
1036163081 8:6406866-6406888 CGGGGGAGAGAGCAGGAGCAGGG - Intronic
1036550706 8:9813008-9813030 CTGGGAAGAAAGGAAGGGCTGGG + Intergenic
1036702392 8:11021568-11021590 CAGCTCAGAGAGCAGTGGCTGGG + Intronic
1037507044 8:19540952-19540974 CTGGGGACAGGGTAGGGGCTTGG - Intronic
1037878507 8:22561281-22561303 CGGGGCAGAAAGCAAGGGCAGGG - Intronic
1037900280 8:22684112-22684134 CTGGGAGCAGAGCAGGGTCTCGG + Intergenic
1037911046 8:22743773-22743795 CTGGGCAGAGGAAAGGGGCGTGG - Intronic
1038317725 8:26501982-26502004 CTGTGCAGGGTGCTGGGGCTGGG - Intronic
1038334078 8:26632396-26632418 CTGGGAAGAGAGTGGGGACTTGG + Intronic
1038863576 8:31414340-31414362 TTGGGCAGAGATCTGGGACTTGG - Intergenic
1039413748 8:37376526-37376548 CTTGGCAGAGAGAAGAGGCGAGG - Intergenic
1039482751 8:37887076-37887098 ATGGGCAGAGGGCAAGGTCTAGG - Intronic
1039546335 8:38413835-38413857 CTGAGCAGGGAGGAGGGGCCCGG - Intronic
1039911272 8:41828816-41828838 CTGGGGAGAGAGTTGGGCCTGGG + Intronic
1040525884 8:48224983-48225005 CTAGGCAGATAGCAAGGGCATGG + Intergenic
1041825566 8:62092999-62093021 ATGGGGAGAGAGAATGGGCTCGG - Intergenic
1043490531 8:80743662-80743684 CTCAGCAGAGAGCTGGGGGTGGG + Intronic
1044002415 8:86899957-86899979 ATGGGCAGAGAGGAGGGGTAGGG - Intronic
1045236646 8:100358000-100358022 CAGGGCAGAAGGCAAGGGCTTGG + Intronic
1045333815 8:101180488-101180510 CTGGGGAGAGGGCAGGGACCTGG - Intronic
1045664048 8:104466950-104466972 CCGGGCTGCGCGCAGGGGCTGGG + Exonic
1046727998 8:117695189-117695211 CTTCTCAGAGAGCAGGGCCTGGG - Intergenic
1048364163 8:133723875-133723897 CAGGCCAGAGTGCAGTGGCTTGG + Intergenic
1048935917 8:139356994-139357016 CTGGGCAGAGAACAGGGTGAAGG - Intergenic
1048971153 8:139645585-139645607 CAGGGCCCAGAGCAGGTGCTAGG + Intronic
1049154230 8:141057092-141057114 TGGGGCAGAGAGAAGGGGGTGGG - Intergenic
1049269105 8:141684739-141684761 CTGGGCAGAGGGCAGACACTGGG - Intergenic
1049464838 8:142746324-142746346 CATGGCAGATAGCTGGGGCTTGG - Intergenic
1049514163 8:143044644-143044666 CAGGGCAGAGGGCAGGTTCTGGG - Exonic
1049519649 8:143081339-143081361 CCGGGCAGAGGGCAGGTGCCAGG + Intronic
1049604916 8:143524837-143524859 GTGGACACAGAGCATGGGCTTGG - Intronic
1049790190 8:144468852-144468874 CTGCCCAGAGAGGAGGGGCTAGG - Intronic
1049804110 8:144531183-144531205 CAGGGCAGAGAGCAGCAGGTGGG + Intronic
1049860386 8:144894291-144894313 CTGGGCAGACAGACGGTGCTGGG - Intronic
1050380132 9:5020085-5020107 CTGGGCAGTGAGCATGGCATGGG + Intronic
1051657498 9:19396993-19397015 CTGGGCATATAGCTGGAGCTAGG + Intergenic
1051735884 9:20198690-20198712 TTGGGGAGAGAGAAGGGGGTGGG - Intergenic
1051836258 9:21341479-21341501 CAGGGGAGACAGCAGGGCCTAGG - Intergenic
1052712171 9:32070083-32070105 GTGCCCAGAGGGCAGGGGCTTGG + Intergenic
1052885334 9:33641353-33641375 CCTGGCAGAGAGCAGTTGCTGGG + Intergenic
1053141031 9:35682817-35682839 GTGGGCTCAGTGCAGGGGCTGGG + Intronic
1053145429 9:35708485-35708507 CTGGGAAGAGAAAAGGGGGTGGG + Intronic
1053199292 9:36141954-36141976 CAGGGCTGAGGGAAGGGGCTGGG - Intronic
1053305927 9:36984915-36984937 CTGGGCTGGGAGCAGGGACCTGG + Intronic
1053428590 9:38027178-38027200 CTGGGCTGAAACCAGGGGCAGGG + Intronic
1053760139 9:41345643-41345665 CTAGGCAGACACCTGGGGCTTGG - Intergenic
1054326592 9:63715785-63715807 CTAGGCAGACACCTGGGGCTTGG + Intergenic
1055060577 9:72064488-72064510 CTTGGCACAGAATAGGGGCTTGG + Intronic
1055385159 9:75753676-75753698 CTGGGTTTAGAGCTGGGGCTGGG + Intergenic
1055397784 9:75892158-75892180 TTGGGCAGGCAGCAGGGGCGCGG + Intronic
1056507095 9:87267889-87267911 CTTGGCAGAGAGAAGGCTCTTGG + Intergenic
1056761986 9:89422345-89422367 CAAGCCAGAAAGCAGGGGCTGGG - Intronic
1056783300 9:89568136-89568158 GTGGGGACAGAGCAAGGGCTTGG - Intergenic
1056823643 9:89861554-89861576 CAGGACAGAGAACAGGGGCAGGG - Intergenic
1056832721 9:89929810-89929832 TGGGGAAGGGAGCAGGGGCTGGG + Intergenic
1056832729 9:89929829-89929851 TGGGGAAGGGAGCAGGGGCTGGG + Intergenic
1056856991 9:90140253-90140275 CTGGGCAGAGGGCTGAGGCCTGG + Intergenic
1057189445 9:93078209-93078231 CTGGCCTAAGAGCAGGGCCTTGG - Intronic
1057213911 9:93217973-93217995 CTGGGCAATGAGGAAGGGCTGGG - Intronic
1057220905 9:93257260-93257282 CTGGCCAGGGAGTTGGGGCTGGG + Intronic
1057307198 9:93919338-93919360 CTGGGCAGAGAGCTGGGGAGGGG - Intergenic
1057447847 9:95130700-95130722 CTGTGGAGAGAACAGTGGCTCGG - Intronic
1057613500 9:96567402-96567424 CTTGGCAGAGCTAAGGGGCTGGG - Intronic
1057814501 9:98284819-98284841 CTTGGCAAAGATCAGGGGCTCGG + Intergenic
1059160915 9:112034557-112034579 ATAGTCAGAGAGCAGCGGCTGGG - Intergenic
1059283157 9:113151419-113151441 CAGGGCGGAGAGCAGCGCCTTGG + Intronic
1059443585 9:114324629-114324651 CTGGGCATGCAGCAGGGGCTGGG + Intronic
1059444778 9:114331406-114331428 CTGGGCACGCAGCAGGGGCTGGG + Intronic
1059468929 9:114488848-114488870 CTGGGCTGAGAGAGGAGGCTGGG - Intronic
1059708419 9:116845085-116845107 CAGTGGAGAGAGCAGGGGCCTGG - Intronic
1060176348 9:121499825-121499847 CTGGGCAGAGCGCAGCGGGTAGG + Intergenic
1060729158 9:126026256-126026278 CTGTGCAGAGTGCATGGACTGGG + Intergenic
1061007185 9:127934960-127934982 CTGGGGATAAAGCAGGGACTGGG - Intergenic
1061039310 9:128130717-128130739 CAGGACAGAGAACAGGGGCAGGG + Intergenic
1061092731 9:128435703-128435725 AGGGGCAGCGAGCAGGGGCTGGG - Exonic
1061180549 9:129022814-129022836 CAGGGCAGGGAGTAGGGTCTGGG + Intronic
1061227913 9:129291390-129291412 AGGGGCAGAGAGTAGGTGCTGGG - Intergenic
1061245936 9:129401383-129401405 CAGGGCCCAGAGCAGGGGCTGGG - Intergenic
1061252014 9:129431999-129432021 CTGGGCCTGGAGCTGGGGCTAGG + Intergenic
1061263713 9:129493970-129493992 GCAGGCAGAGAGTAGGGGCTAGG + Intergenic
1061480681 9:130896432-130896454 CCGGGCAAGGAGCAGAGGCTGGG - Intergenic
1061646684 9:132008690-132008712 CTGTGCAGAGAGCACAGGCGTGG - Intronic
1061677679 9:132227665-132227687 GTGGGCAGAGAGCACGTGCGGGG - Intronic
1061678660 9:132231883-132231905 CTGGGCAGAGAGCAGGGGCTTGG + Intronic
1061803799 9:133127283-133127305 CTGGGCACAGGGCAGTGACTGGG + Intronic
1061877901 9:133554145-133554167 CTGGGAACAGGGCGGGGGCTGGG - Intronic
1061923435 9:133794611-133794633 CTGCCCAGAGGGCAGGGGCCAGG + Intronic
1061967567 9:134025020-134025042 CTGGGAAAGGAGGAGGGGCTGGG - Intergenic
1062020927 9:134319146-134319168 CAGGGCAGAGACATGGGGCTGGG + Intronic
1062025581 9:134338756-134338778 CTGGGCACAGTGCAGGGGTCTGG - Intronic
1062036754 9:134385892-134385914 CTGGGCAGAGGACAAGGGCAAGG - Intronic
1062402535 9:136378793-136378815 CGGGGCCCAGGGCAGGGGCTTGG + Exonic
1062640673 9:137516403-137516425 CTTGGCAGAGACCAGGGCCGGGG - Intronic
1062694282 9:137865211-137865233 CTGGACACAGAGAGGGGGCTGGG + Intronic
1202793363 9_KI270719v1_random:101340-101362 CTAGGCAGACACCTGGGGCTTGG + Intergenic
1203521866 Un_GL000213v1:53097-53119 CTGAGCACAGTGCAGGTGCTGGG - Intergenic
1185575697 X:1170467-1170489 CTGGGCACACAGCAGGGGAGAGG - Intergenic
1185765932 X:2725906-2725928 ATGGAAAGAGAGCTGGGGCTGGG - Intronic
1187921894 X:24211945-24211967 CTGAGTAAAGAGCAGTGGCTGGG + Exonic
1189224214 X:39398910-39398932 CTGGGGAGAGAGTGGGGGGTGGG + Intergenic
1189757072 X:44282862-44282884 CTGGGCAGTGAGAAGAGGCGTGG + Intronic
1189883038 X:45511550-45511572 CTGGTCAGAAAGCAGGGGATGGG - Intergenic
1190493653 X:51006664-51006686 CAGGGCAGAGGACAGGGGCAGGG + Intergenic
1191659594 X:63635979-63636001 CTGGGGAGAGGGCCGGGGCTCGG - Exonic
1191870513 X:65741212-65741234 CTGGGTTGAGAGCAAGGGGTGGG - Exonic
1195006119 X:100687529-100687551 GTGGGCAGGGAGCAGAGGCAAGG + Intronic
1195079767 X:101359575-101359597 CAGGGAAGAGATCAGGGACTAGG + Intronic
1195910853 X:109887215-109887237 CTGGGAAGTGAGCAGGAGATAGG + Intergenic
1197898522 X:131342977-131342999 GTTGGCAGGGAGCAGGGGGTAGG + Intronic
1198815736 X:140588255-140588277 ATGTTCAGAGAGAAGGGGCTGGG - Intergenic
1199712269 X:150477734-150477756 GTGGGCAGAGAGGAGGGGGAAGG + Intronic
1199853576 X:151741957-151741979 CTGGGGAGAGAGCAGAGTCAGGG - Intronic
1200018259 X:153181425-153181447 CTGGGGTGACAGCAGGGGCAGGG - Intronic
1200133357 X:153863185-153863207 CTGTGTGGAGAGGAGGGGCTGGG + Intronic
1200219275 X:154383209-154383231 AGGGGCAGAGGGCAGGGGCTTGG - Intergenic
1200972466 Y:9167909-9167931 CTGGTGAGAGAGCTTGGGCTTGG + Intergenic
1201493578 Y:14569264-14569286 CTGGGGAGAAAGCAGGGTATGGG - Intronic
1202378748 Y:24259267-24259289 CCCTGCACAGAGCAGGGGCTGGG - Intergenic
1202492034 Y:25410854-25410876 CCCTGCACAGAGCAGGGGCTGGG + Intergenic