ID: 1061679977

View in Genome Browser
Species Human (GRCh38)
Location 9:132238192-132238214
Sequence CACCATCCCTAAGAATGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061679977_1061679987 12 Left 1061679977 9:132238192-132238214 CCCCCCCATTCTTAGGGATGGTG 0: 1
1: 0
2: 0
3: 3
4: 111
Right 1061679987 9:132238227-132238249 AAATCCTCCATTGACAATGTGGG No data
1061679977_1061679986 11 Left 1061679977 9:132238192-132238214 CCCCCCCATTCTTAGGGATGGTG 0: 1
1: 0
2: 0
3: 3
4: 111
Right 1061679986 9:132238226-132238248 CAAATCCTCCATTGACAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061679977 Original CRISPR CACCATCCCTAAGAATGGGG GGG (reversed) Intronic
902535682 1:17118321-17118343 CTCCAACCCTAGCAATGGGGAGG + Intronic
904787508 1:32993824-32993846 CAGCAACTCTGAGAATGGGGAGG - Intergenic
905927974 1:41765509-41765531 CAGCATCCTTAAGAATAGGATGG + Intronic
906645084 1:47469041-47469063 CCCCACCCCTAAGAAGGGGGTGG - Intergenic
924035249 1:239929869-239929891 GACCATCCCTAATAATAGGAAGG - Intergenic
1069374123 10:67776733-67776755 CATCACCCCTAAGAAGGGAGAGG + Intergenic
1074661873 10:115668177-115668199 CACCACCCCTAAGCTTGGAGGGG - Intronic
1080872682 11:36250871-36250893 CCCCTTCCCTAAGCATGGGCTGG + Intergenic
1082867722 11:57914861-57914883 CACCATCCCTCAGAATGTGATGG - Intergenic
1083152014 11:60797917-60797939 CACCATCCTTACCGATGGGGAGG - Intronic
1091226410 11:133958888-133958910 CTCCATACCTAACAATGGTGAGG - Intergenic
1093470060 12:19491299-19491321 CAACAACCCTAAGAATGGCATGG - Intronic
1095222153 12:39628489-39628511 AAACATCCCTAACAATGGAGGGG - Intronic
1097007982 12:55932353-55932375 CACCATCCCTCCGAATGAGCGGG - Intronic
1102254705 12:111408767-111408789 CACCAGCCCTCAGAAGGGTGTGG - Intronic
1103592581 12:122002823-122002845 CACCATCACCAAGACTGAGGAGG + Intronic
1104013762 12:124949342-124949364 CACCAGCCCCAGGAAGGGGGAGG + Intronic
1104625013 12:130344861-130344883 GGCCATCCCTAACCATGGGGAGG + Intronic
1105841425 13:24256868-24256890 CACCATCCCCAACAATGCAGTGG - Intronic
1105850618 13:24331903-24331925 CACCATCACAAAGAAGGAGGAGG - Intergenic
1105957871 13:25301193-25301215 CCCCATCCCTAAGAAGGAAGGGG - Intergenic
1106644666 13:31619237-31619259 CACCAACTCTAATAATGGTGGGG + Intergenic
1107337006 13:39365874-39365896 TACCATTCCTAAGAATAGTGAGG + Intronic
1107344856 13:39448073-39448095 CACCACCCCTGAGAACTGGGAGG - Intronic
1108769211 13:53677800-53677822 GTCCATTACTAAGAATGGGGTGG + Intergenic
1112285068 13:98096805-98096827 CACCACCCCTAGGAATGAGCCGG + Intergenic
1112297272 13:98198923-98198945 CACCATACCTAAGTTTGTGGGGG - Intronic
1115386803 14:32807045-32807067 CTCCATCTCAAAGAAAGGGGGGG + Intronic
1116640031 14:47449155-47449177 CACCATTCCTAAAAATGTGAAGG + Intronic
1117988335 14:61410217-61410239 CACCATTTTTAAGAACGGGGTGG - Intronic
1118814162 14:69298227-69298249 CACCAGCCCTGAGAAAGAGGGGG - Intronic
1120954028 14:90065818-90065840 CACGATCCCAAGGAATGGTGGGG + Intronic
1124018938 15:25902585-25902607 CTCCATCCCCAAGAATTGTGTGG - Intergenic
1124201944 15:27686309-27686331 CTCCATCCCTAAGCACAGGGAGG + Intergenic
1129385477 15:75193916-75193938 CACCATCTCTCACAATGGGAAGG + Intergenic
1132035177 15:98477320-98477342 CTCCATCTCCAACAATGGGGGGG + Intronic
1134234847 16:12457402-12457424 CCCAATCACTAAGAGTGGGGAGG - Intronic
1138432055 16:56975335-56975357 CACCGACCCTATGAGTGGGGCGG + Intronic
1138839856 16:60487383-60487405 CACCACCCCAAAAACTGGGGAGG + Intergenic
1145043033 17:19591027-19591049 CACCAGCCCCAAGAGAGGGGAGG - Intergenic
1146320369 17:31841962-31841984 CACCATCCATAACCATGGAGAGG - Intergenic
1147158503 17:38557648-38557670 CTCCATGCCTAAGCATGCGGAGG + Intronic
1150012426 17:61517441-61517463 CGCCATCCCTATAAATGTGGAGG - Intergenic
1153571304 18:6475934-6475956 CACCCTCCCTAGGAAGAGGGTGG - Intergenic
1155338167 18:24785962-24785984 CTCCAACCCTAAGGTTGGGGAGG + Intergenic
1160049868 18:75422787-75422809 CAGGGTCTCTAAGAATGGGGAGG + Intronic
1163846005 19:19638320-19638342 CATCATCCCCCAGAATGAGGCGG - Exonic
1164210445 19:23093531-23093553 CCCCACCCCCAAGAATGAGGGGG - Intronic
927180114 2:20439773-20439795 CTCCAACCCTGAGAATTGGGAGG - Intergenic
928415342 2:31087106-31087128 CACCAGCCATAAGAAAGGGATGG + Intronic
931994622 2:67828069-67828091 CACCCTCACTCAGGATGGGGAGG - Intergenic
934125205 2:88881777-88881799 CACCATCCCCAAAAATGCAGTGG - Intergenic
935102076 2:100006631-100006653 CAGCATCCCCAAGCAGGGGGAGG - Exonic
937215739 2:120312263-120312285 CACCATCCCTGATGCTGGGGCGG + Intergenic
941357027 2:164506192-164506214 CAGAATCCTTAAGGATGGGGCGG + Intronic
943702376 2:191000517-191000539 CACCAGCCCTAACAGTGGAGAGG + Intronic
944414713 2:199469927-199469949 CACCTTCCAGAAAAATGGGGAGG + Intronic
1168851158 20:978027-978049 CACCATCTCTAGCAAGGGGGTGG + Intronic
1178891403 21:36523853-36523875 CACCATCCCTAATAACAGGTGGG + Intronic
1182032952 22:27174631-27174653 CACCATCCCTAGGCCTGAGGGGG + Intergenic
1182656809 22:31897171-31897193 CAACATCCCCTAGAATGGGAAGG + Intronic
1184369696 22:44074647-44074669 CACCATCCCTGAGAAGAGGAGGG + Intronic
1184411328 22:44328071-44328093 AAGCATCCCTAAGAAGGGAGGGG + Intergenic
954004841 3:47582589-47582611 CACCATCCCCCAGAAAGGGAAGG + Intergenic
954680729 3:52344607-52344629 CACCCTCCCCAAGAAGGAGGAGG + Exonic
956625054 3:71258836-71258858 CAGTAGCCCTAAGAATGGGATGG + Intronic
958580440 3:96012583-96012605 CACCATCCATAGGAATTGTGGGG + Intergenic
959717858 3:109453090-109453112 CACCATCCCCAAAAATGCAGTGG - Intergenic
959981650 3:112524338-112524360 CACCACCCCCAGGAATGGTGTGG - Intergenic
963007423 3:140739059-140739081 CACAAGCCCTAAGAATGTGATGG + Intergenic
964517958 3:157533283-157533305 CACCAACCCTAAGGAAGGAGTGG + Intronic
967890681 3:194362291-194362313 CAACAGCCCCAAGAACGGGGCGG - Intronic
969542790 4:7803967-7803989 CACCATTTCTCAAAATGGGGAGG + Intronic
972468663 4:39383511-39383533 CACCATCACTAAGACTGTGCTGG + Intergenic
973669154 4:53197100-53197122 CATCATCCCAAAGCATGGCGGGG + Intronic
974463442 4:62220883-62220905 TACCATCCCTAAAAAAGTGGAGG - Intergenic
976971579 4:91109099-91109121 CTAAATGCCTAAGAATGGGGTGG - Intronic
983617430 4:169723928-169723950 CACCCTCTATAAAAATGGGGTGG - Intergenic
984127862 4:175834306-175834328 CACCATCCCTTAGAATTGTTCGG + Intronic
984821787 4:183888802-183888824 CACCATCCAAAAGAATGAAGTGG - Intronic
989464731 5:41741511-41741533 CACCATCCCTGAGACAGTGGGGG + Intronic
991130090 5:63112142-63112164 TAGCATCCATGAGAATGGGGTGG + Intergenic
991630533 5:68652451-68652473 CTTCATCCCTAGGGATGGGGTGG - Intergenic
994095364 5:95842867-95842889 CACCATCCCAAATGCTGGGGTGG - Intergenic
994323136 5:98416091-98416113 CACCACCTTTAAGGATGGGGCGG - Intergenic
994974103 5:106780031-106780053 CACCATACCTGGGAATGGGCTGG - Intergenic
997367577 5:133335669-133335691 CACCCCCCCCAAGAAAGGGGAGG - Intronic
1002155655 5:177276645-177276667 CATCATCTCTAATAAAGGGGGGG - Intronic
1008893672 6:56526393-56526415 CACCATCACTCAGAAGGTGGAGG - Exonic
1010134221 6:72531802-72531824 TGCCATCCCTAAGCAAGGGGTGG + Intergenic
1013159254 6:107525527-107525549 CACCTTCCCCAAGAATGCTGTGG + Intronic
1014334675 6:120118192-120118214 CAACATTCCTAAGGATGCGGTGG + Intergenic
1020961464 7:14809475-14809497 CACCATCCCCAAGAACATGGAGG + Intronic
1026286491 7:68968117-68968139 ATCCATCCCTGAGAGTGGGGTGG + Intergenic
1027497505 7:78906506-78906528 TACCATCCCTGAGAGTGGAGAGG + Intronic
1029030530 7:97461870-97461892 CAACCTCCCTAAGAATTTGGAGG + Intergenic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1031635142 7:124093127-124093149 CACCATCACAAAAAATTGGGGGG + Intergenic
1034349444 7:150406629-150406651 CAACAGCCCTGAGAAAGGGGCGG - Intronic
1037948360 8:23003516-23003538 CATCCTCCCTAGGAATGGGAAGG + Intronic
1038245244 8:25848988-25849010 CACATTCCCTAAGGATGGGATGG + Intronic
1042367742 8:67955780-67955802 CACTATCCTTAAAAATGGAGTGG - Intronic
1044751832 8:95423512-95423534 CACCATCCTTGAGAAAGAGGGGG + Intergenic
1045295126 8:100865871-100865893 CCCCATCTCTAAGAAAGGAGAGG - Intergenic
1048614532 8:136059101-136059123 CACCTTCCCTCAGGCTGGGGAGG + Intergenic
1050211540 9:3263999-3264021 AACCATCCCTAGGAATGAAGGGG - Intronic
1051507279 9:17840855-17840877 CACTTTCCCTAAGAAAGGAGAGG + Intergenic
1052738513 9:32370327-32370349 CAAAATCCCTAAGCATGAGGAGG + Intergenic
1056749543 9:89337755-89337777 CTCCCTCCATCAGAATGGGGAGG - Intronic
1060061690 9:120466363-120466385 CATCATCCCCCAGAATGGGATGG - Intronic
1061679977 9:132238192-132238214 CACCATCCCTAAGAATGGGGGGG - Intronic
1061709789 9:132479837-132479859 CACCAAGCCTATGAATTGGGTGG + Intronic
1062085952 9:134648540-134648562 CCCCATCTGTAAGAAGGGGGTGG + Intronic
1062325650 9:136011224-136011246 CACCCTCCCCAAGAAGGGGGAGG + Exonic
1189236053 X:39488307-39488329 CACAAGCCCAAAGACTGGGGTGG - Intergenic