ID: 1061680844

View in Genome Browser
Species Human (GRCh38)
Location 9:132241801-132241823
Sequence CCTGCTTCGCAGGAGCTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061680839_1061680844 -7 Left 1061680839 9:132241785-132241807 CCGGGATCTCGCACACCCTGCTT 0: 1
1: 0
2: 1
3: 5
4: 107
Right 1061680844 9:132241801-132241823 CCTGCTTCGCAGGAGCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 91
1061680828_1061680844 20 Left 1061680828 9:132241758-132241780 CCTACATCCCCGGCCCAGACGGC 0: 1
1: 0
2: 0
3: 22
4: 193
Right 1061680844 9:132241801-132241823 CCTGCTTCGCAGGAGCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 91
1061680834_1061680844 7 Left 1061680834 9:132241771-132241793 CCCAGACGGCGCCCCCGGGATCT 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1061680844 9:132241801-132241823 CCTGCTTCGCAGGAGCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 91
1061680836_1061680844 -4 Left 1061680836 9:132241782-132241804 CCCCCGGGATCTCGCACACCCTG 0: 1
1: 0
2: 1
3: 0
4: 95
Right 1061680844 9:132241801-132241823 CCTGCTTCGCAGGAGCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 91
1061680829_1061680844 13 Left 1061680829 9:132241765-132241787 CCCCGGCCCAGACGGCGCCCCCG 0: 1
1: 0
2: 0
3: 21
4: 294
Right 1061680844 9:132241801-132241823 CCTGCTTCGCAGGAGCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 91
1061680835_1061680844 6 Left 1061680835 9:132241772-132241794 CCAGACGGCGCCCCCGGGATCTC 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1061680844 9:132241801-132241823 CCTGCTTCGCAGGAGCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 91
1061680830_1061680844 12 Left 1061680830 9:132241766-132241788 CCCGGCCCAGACGGCGCCCCCGG 0: 1
1: 0
2: 4
3: 20
4: 303
Right 1061680844 9:132241801-132241823 CCTGCTTCGCAGGAGCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 91
1061680837_1061680844 -5 Left 1061680837 9:132241783-132241805 CCCCGGGATCTCGCACACCCTGC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1061680844 9:132241801-132241823 CCTGCTTCGCAGGAGCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 91
1061680832_1061680844 11 Left 1061680832 9:132241767-132241789 CCGGCCCAGACGGCGCCCCCGGG 0: 1
1: 0
2: 1
3: 20
4: 256
Right 1061680844 9:132241801-132241823 CCTGCTTCGCAGGAGCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 91
1061680838_1061680844 -6 Left 1061680838 9:132241784-132241806 CCCGGGATCTCGCACACCCTGCT 0: 1
1: 0
2: 1
3: 11
4: 105
Right 1061680844 9:132241801-132241823 CCTGCTTCGCAGGAGCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 91
1061680824_1061680844 30 Left 1061680824 9:132241748-132241770 CCTGGAGCCTCCTACATCCCCGG 0: 1
1: 0
2: 0
3: 17
4: 184
Right 1061680844 9:132241801-132241823 CCTGCTTCGCAGGAGCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 91
1061680826_1061680844 23 Left 1061680826 9:132241755-132241777 CCTCCTACATCCCCGGCCCAGAC 0: 1
1: 0
2: 4
3: 38
4: 298
Right 1061680844 9:132241801-132241823 CCTGCTTCGCAGGAGCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061680844 Original CRISPR CCTGCTTCGCAGGAGCTCGG AGG Intronic
901839391 1:11944588-11944610 CCGTCCTGGCAGGAGCTCGGGGG + Intronic
905201989 1:36321971-36321993 CCTGCGTGGCAGGAGCCTGGGGG + Intronic
920112666 1:203598231-203598253 CCTGCCTTGTAGGAGCTCTGTGG + Intergenic
922578130 1:226676997-226677019 GCTGCTTCCCAGGTGCTCAGGGG - Intronic
922753669 1:228082614-228082636 CCTGCGTCGCGGGCGCACGGTGG + Intergenic
1064742532 10:18448357-18448379 CCAGCTACTCAGGAGCTCTGAGG + Intronic
1067140048 10:43648937-43648959 CCGGCTTCCCAAGAGCTCTGTGG + Intergenic
1073440472 10:103549685-103549707 CCTGCTGTGGAGGAGCTGGGAGG - Intronic
1073578515 10:104643460-104643482 CCAGCTTCGCAGCAGCGCGATGG + Intronic
1075802356 10:125160998-125161020 CTGGCTGCGCAGGAGCTAGGCGG + Intronic
1076166680 10:128287716-128287738 CCTGCTTTGCAGGGGCACTGGGG - Intergenic
1076718448 10:132380763-132380785 TCTGCTTCTCAGGAGCTCTTTGG - Intergenic
1077230871 11:1457666-1457688 CCTGCATCTCAGCAGCTCCGTGG + Intronic
1081866176 11:46361865-46361887 CTGGCTCAGCAGGAGCTCGGGGG - Intronic
1085496396 11:76973528-76973550 CATGCTTCCCTGGAGCTGGGTGG - Intronic
1089949708 11:122514251-122514273 CCTGCTTTTAAGGAGCTCAGAGG + Intergenic
1098558844 12:71850386-71850408 CCTGCTCAGAAGGAGCTGGGTGG - Intronic
1100459938 12:94789473-94789495 CTTGCTTGGGAGGAGCTAGGCGG - Intergenic
1101591582 12:106129891-106129913 CCTGCTACCCAGGAGCTAGATGG - Intronic
1101641381 12:106587520-106587542 CCTGCTTCCCAGAGGCTCCGAGG + Intronic
1102354728 12:112223175-112223197 CATGCTTCCCAGGAGTTCTGAGG + Intronic
1102463468 12:113114674-113114696 ACAGCTGCTCAGGAGCTCGGTGG - Intronic
1112291000 13:98143684-98143706 CCACCATCGCAGGAGCTCGGGGG + Intronic
1113082484 13:106534245-106534267 CCTGCTTCGCAGGAGAACTCGGG - Intronic
1113932069 13:113973875-113973897 CCTGCTTCGCTGAAGTTCAGAGG + Intergenic
1117196035 14:53341106-53341128 GCTGCTTCTCAGGAACTTGGAGG - Intergenic
1121187056 14:91982713-91982735 CCTGCATGGCAGCAGCTGGGCGG + Intronic
1121564898 14:94901884-94901906 TCTGCTTTGCAGAAGCTGGGAGG + Intergenic
1124499564 15:30215189-30215211 CCAGCTGCACAGGAGCTCCGTGG - Intergenic
1124744015 15:32323472-32323494 CCAGCTGCACAGGAGCTCCGTGG + Intergenic
1128095369 15:64949993-64950015 GCTGCTTCTCAGGAGCTGGGTGG + Intronic
1132646952 16:1003564-1003586 CCTGCTGGCCAGGAGCCCGGTGG + Intergenic
1133293425 16:4737647-4737669 CCTGCTGCTCAGGAGCCTGGGGG - Intronic
1137720752 16:50625986-50626008 CATGCTGCCCAGGAGCTTGGGGG + Intronic
1139573923 16:67829614-67829636 CCTGCTTGGCTGGAGCTAGGTGG - Intronic
1141809759 16:86368001-86368023 GCTGCTTCAAAGGGGCTCGGGGG + Intergenic
1147017704 17:37505796-37505818 CCCGCATCCCAGGAGCTCTGTGG + Intronic
1149246155 17:54710925-54710947 TTTGCTTTGCAGGAGCTCTGTGG - Intergenic
1152523728 17:80875717-80875739 CCTGCGTGGCACGGGCTCGGTGG - Intronic
1152523821 17:80876154-80876176 CCTGCGTGGCACGGGCTCGGTGG - Intronic
1152523842 17:80876251-80876273 CCTGCGTGGCACGGGCTCGGTGG - Intronic
1152523863 17:80876348-80876370 CCTGCGTGGCACGGGCTCGGTGG - Intronic
1152523873 17:80876397-80876419 CCTGCGTGGCACGGGCTCGGTGG - Intronic
1152523883 17:80876446-80876468 CCTGCGTGGCACGGGCTCGGTGG - Intronic
1152523893 17:80876495-80876517 CCTGCGTGGCACGGGCTCGGTGG - Intronic
1152523948 17:80876735-80876757 CCTGCGTGGCACGGGCTCGGTGG - Intronic
1152524002 17:80876976-80876998 CCTGCATGGCACGGGCTCGGTGG - Intronic
1152572274 17:81126068-81126090 CCTGCTTCGAAGGACCCTGGAGG - Intronic
1152684128 17:81685522-81685544 CCAGCTTGGCAGCAGCTGGGGGG - Intronic
1153952708 18:10070534-10070556 CCTGCTTCGCAGGTGGATGGAGG - Intergenic
1161583355 19:5092473-5092495 TCTGCTGCCCAGGAGCTCCGGGG + Intronic
1168035716 19:53717721-53717743 CCTGCTTAGCAAGAGCACGGAGG + Intergenic
1168041834 19:53765050-53765072 ACTGCTTAGCAAGAGCACGGAGG + Intergenic
925023631 2:590673-590695 CTTGTTTCCCAGGACCTCGGTGG - Intergenic
929670590 2:43874044-43874066 CCCGCTCCCCAGGAGCTCAGAGG - Intronic
933983952 2:87575295-87575317 CCTGCTTTGCTGGGGCTGGGGGG + Intergenic
936309903 2:111375501-111375523 CCTGCTTTGCTGGGGCTGGGGGG - Intergenic
1180628746 22:17212384-17212406 CCAGCTACTCAGGAGCTGGGAGG - Intronic
1181163329 22:20970393-20970415 CCTGCTACTCAGGAGGTGGGAGG - Intronic
1182028352 22:27137931-27137953 GCTGCTTCTCAGCAGCTGGGTGG + Intergenic
1183961211 22:41412995-41413017 CCTGCTTCCCAGGACCGAGGAGG - Intergenic
1185278233 22:49959044-49959066 CCTCCTTCGCAGGTGCTGTGTGG + Intergenic
950503940 3:13381894-13381916 CCAGCTCCGCAGGAGCTCCATGG - Intronic
952879349 3:37973637-37973659 CCTGCTGCCCAGGAGCCCGCAGG + Intronic
953686632 3:45083104-45083126 CCTGCTTGGAAGGGGCTGGGAGG + Exonic
963786385 3:149538779-149538801 CCTGCTTCACAGGGGCCCAGTGG - Intronic
964749164 3:160038909-160038931 CCTGCTCCGCACGACCTCTGCGG + Intergenic
967102740 3:186229683-186229705 CCTGCTTTTCAGGAGTTCGTGGG - Intronic
967752451 3:193129815-193129837 CCTGCTTCCCAGCACCTCTGTGG - Intergenic
968572142 4:1347396-1347418 CCGGCTTCGACGGTGCTCGGGGG - Exonic
969299461 4:6289100-6289122 GCTGCTTCGCCGGTGCTTGGCGG + Exonic
969391588 4:6894905-6894927 GCTTCTCCGCAGGAGCTCAGGGG - Intergenic
973590653 4:52437368-52437390 CCTGCCTAGCAGGAGATGGGAGG + Intergenic
982677773 4:158395776-158395798 CCTGCATCCCAGGAACTTGGAGG - Intronic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
992104364 5:73437446-73437468 GCTGGTTCGCAGCAGCTCGGCGG + Intergenic
994183576 5:96794707-96794729 CCTGCTTGGCAGGAACCCAGAGG - Intronic
997431489 5:133844093-133844115 GCTGCTGCCCAGGAGCTCTGAGG + Intergenic
1003378076 6:5597415-5597437 CCTGCTTCCCAAGAGCTCATAGG - Intronic
1012602383 6:101114269-101114291 TCTGCTTAGCAGGAGCTCAAAGG + Intergenic
1017347527 6:153401924-153401946 GCAGCTTTGCAGGAGCTCAGAGG - Intergenic
1018139192 6:160810513-160810535 GCAGCTTTGCAGGAGCTCAGAGG + Intergenic
1023418040 7:39950426-39950448 CCTGCTTCCCTGGGGCCCGGAGG + Exonic
1033591190 7:142809699-142809721 CCTGCTCTGCAGGAGCTCAAGGG + Intergenic
1035160785 7:156948994-156949016 CCTGCTTCTCAGGAGAACGCTGG + Intergenic
1041709922 8:60885129-60885151 CCTGCTTCTCACCAGCTGGGTGG - Intergenic
1042795801 8:72662272-72662294 CCTGCTTTTCAGGAACTCAGTGG + Intronic
1048637700 8:136316388-136316410 CCTGGTTGCCAGGAGCTGGGAGG - Intergenic
1049056046 8:140238432-140238454 CCTGCTTCCCTGGAGCTCTCAGG - Intronic
1049564628 8:143331763-143331785 CCTGCCTCCGAGGAGCTGGGTGG + Intronic
1049681555 8:143920851-143920873 CCTGCTCTCCAGCAGCTCGGCGG + Exonic
1052778896 9:32760427-32760449 CCTGCTATGCAGGAGATCTGCGG - Intergenic
1056831689 9:89922406-89922428 CCTGCCTCACTGGAGCTTGGTGG + Intergenic
1061680844 9:132241801-132241823 CCTGCTTCGCAGGAGCTCGGAGG + Intronic
1062537972 9:137029161-137029183 CCTGCTGCAAAGGAGCTGGGAGG - Intronic
1194910798 X:99642019-99642041 CCTGCTCTGCAGGAGCTGGCTGG - Intergenic
1199497811 X:148472616-148472638 TCTGCTTCTCAAGAGCTTGGAGG + Intergenic