ID: 1061680928

View in Genome Browser
Species Human (GRCh38)
Location 9:132242123-132242145
Sequence AGGACGCTCCCCGCACCCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 77}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061680912_1061680928 28 Left 1061680912 9:132242072-132242094 CCTGCTGCTGCTGGGGCTGGCCG 0: 1
1: 1
2: 9
3: 58
4: 520
Right 1061680928 9:132242123-132242145 AGGACGCTCCCCGCACCCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 77
1061680918_1061680928 1 Left 1061680918 9:132242099-132242121 CCTGGGCCGCTGAGCCCCGCCCG 0: 1
1: 1
2: 2
3: 49
4: 383
Right 1061680928 9:132242123-132242145 AGGACGCTCCCCGCACCCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 77
1061680916_1061680928 5 Left 1061680916 9:132242095-132242117 CCCGCCTGGGCCGCTGAGCCCCG 0: 1
1: 0
2: 4
3: 43
4: 469
Right 1061680928 9:132242123-132242145 AGGACGCTCCCCGCACCCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 77
1061680921_1061680928 -5 Left 1061680921 9:132242105-132242127 CCGCTGAGCCCCGCCCGGAGGAC 0: 1
1: 0
2: 0
3: 21
4: 292
Right 1061680928 9:132242123-132242145 AGGACGCTCCCCGCACCCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 77
1061680917_1061680928 4 Left 1061680917 9:132242096-132242118 CCGCCTGGGCCGCTGAGCCCCGC 0: 1
1: 0
2: 3
3: 33
4: 309
Right 1061680928 9:132242123-132242145 AGGACGCTCCCCGCACCCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 77
1061680915_1061680928 8 Left 1061680915 9:132242092-132242114 CCGCCCGCCTGGGCCGCTGAGCC 0: 1
1: 0
2: 2
3: 51
4: 702
Right 1061680928 9:132242123-132242145 AGGACGCTCCCCGCACCCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061680928 Original CRISPR AGGACGCTCCCCGCACCCGG AGG Exonic
900985796 1:6072254-6072276 ATGGAGCTCCCCGCACCCCGAGG + Intronic
902920828 1:19665260-19665282 AGCAGGCTCCCCGCGGCCGGTGG - Intergenic
905256276 1:36687527-36687549 AGGCCTCTCCCGGCCCCCGGTGG - Intergenic
907080432 1:51617014-51617036 AGGACCCGCCCCGCCCCCTGCGG + Intronic
911057405 1:93720737-93720759 AGGATGCTCCCCGGAGCCAGAGG + Intronic
916729475 1:167553437-167553459 ACGCCGCTGCCCGCGCCCGGGGG + Exonic
920534953 1:206731393-206731415 AGGACGCACCCCGCAGGCGTGGG - Intronic
1077015555 11:397596-397618 AGGCCGCTCCCAGCACCTGCAGG - Exonic
1081617973 11:44601620-44601642 AGGAAGCTCTCCCCACCCAGTGG - Intronic
1081994549 11:47355126-47355148 AGGACGCTCCCGGGGCCCAGAGG - Exonic
1083968664 11:66058871-66058893 AGGACACCCCTCGCACCCGCTGG - Exonic
1084319697 11:68366397-68366419 AGGACTCTCCTGGCATCCGGTGG + Intronic
1091239552 11:134043436-134043458 AGGCTGCTCCCCGCCCCTGGTGG + Intergenic
1092183025 12:6458941-6458963 AGGACACTCCCAGTACCTGGTGG - Exonic
1098426176 12:70367074-70367096 AGAACGCCCCGCGCACCCAGGGG + Intronic
1108542517 13:51456884-51456906 AGGAAGCTCCCTGCTCCCGCAGG - Intergenic
1113884128 13:113648710-113648732 AGGACGCTCACAGCTCCGGGAGG - Intergenic
1118338919 14:64879232-64879254 GGGTGGCTCCCAGCACCCGGAGG + Intronic
1120881316 14:89417085-89417107 AGGACGCGCGGCGCGCCCGGCGG - Intronic
1122658665 14:103279601-103279623 GGGGCGCTCCCCGTTCCCGGAGG + Intergenic
1125181843 15:36887545-36887567 GGGACGGTCTCCCCACCCGGCGG + Intergenic
1131621235 15:94070524-94070546 AGGTGGCGCCCTGCACCCGGCGG - Intergenic
1132074629 15:98809879-98809901 AGCCCACTCCCCGCACCCTGGGG + Intronic
1132501185 16:285412-285434 AGGCAGCTCCCCGCTTCCGGGGG + Exonic
1133270677 16:4609607-4609629 AGGCCCCTCCCCCCTCCCGGAGG - Exonic
1133843005 16:9427476-9427498 AAGACGATCCCAGCACCTGGGGG + Intergenic
1134002816 16:10795835-10795857 AGGAGGCTCCCAGCGCCTGGCGG - Intronic
1134174933 16:11998030-11998052 AGGATGCGCCCAGCACACGGTGG + Intronic
1136254541 16:29029396-29029418 AGGCAGCTCCCGGCAGCCGGGGG + Intergenic
1136724763 16:32348815-32348837 CGGACGCGGCCCGGACCCGGTGG - Intergenic
1136843089 16:33554855-33554877 CGGACGCGGCCCGGACCCGGTGG - Intergenic
1136913732 16:34162917-34162939 AGGGCGCTCCCAACACCAGGAGG - Intergenic
1140456352 16:75107757-75107779 AGGAGGCTCACCGGACCCTGGGG + Exonic
1141143985 16:81516027-81516049 AGGAAGCTGCCCCCACCCGCAGG - Intronic
1141760495 16:86025848-86025870 AGGAGGCTCCCCACCCCCGGGGG + Intergenic
1203001667 16_KI270728v1_random:168940-168962 CGGACGCGGCCCGGACCCGGTGG + Intergenic
1203133271 16_KI270728v1_random:1705346-1705368 CGGACGCGGCCCGGACCCGGTGG + Intergenic
1203153254 16_KI270728v1_random:1855153-1855175 CGGACGCGGCCCGGACCCGGTGG - Intergenic
1142693562 17:1621233-1621255 AGGAGCCTCCCCACACCCCGGGG + Intronic
1149658817 17:58324147-58324169 AGAAGCCTCCCCCCACCCGGAGG + Intronic
1151728162 17:75896405-75896427 ATGAGGCTCCCCGCCCCCGCCGG + Intronic
1152528954 17:80905802-80905824 AGGAGGCCCCCCACTCCCGGCGG - Intronic
1155916777 18:31565115-31565137 AGGTCTCTCCCTGCACCCAGAGG + Intergenic
1160673915 19:378526-378548 AGAACTCTGCCCGCACTCGGGGG + Intergenic
928023494 2:27721724-27721746 AGGACGCTTCCTGCTCCAGGTGG - Intergenic
937246877 2:120499324-120499346 AGGATGCTGCCCGCAGCCGAGGG - Intergenic
948928988 2:241118829-241118851 TGTACACACCCCGCACCCGGTGG + Intronic
1171810331 20:29741681-29741703 AGGGCGCTCCCAACACCGGGAGG + Intergenic
1175792718 20:61751957-61751979 AGGAAGCTTTCCACACCCGGGGG - Intronic
1176023146 20:62972856-62972878 AGGACACGCTGCGCACCCGGGGG - Intergenic
1176132881 20:63503687-63503709 AGGACCCTGCCTGCACCCTGGGG + Intergenic
1176177827 20:63737047-63737069 AGGAGGGACCCTGCACCCGGAGG - Intronic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1183786282 22:40030871-40030893 AGGACACTACCAGCACCTGGGGG + Exonic
1185336183 22:50271793-50271815 AGGCCGCTCCCCTCCCCCGGCGG - Intergenic
950088581 3:10278739-10278761 AGGACTCTCCCTGCACCTGCAGG + Exonic
950532396 3:13559878-13559900 AGGACTCCCCCCGCCCCAGGCGG + Intronic
962816662 3:139006388-139006410 AGGACTCTCCCCGCGCCGCGCGG - Intronic
963028397 3:140942233-140942255 GGGTCGCTCCCCTCACCCGCAGG - Intronic
973532251 4:51844651-51844673 AGGCCGCGCCCCACGCCCGGGGG + Intronic
978503478 4:109433597-109433619 GGGTCGCTCCCCGCACGCGCGGG - Intergenic
980282179 4:130736640-130736662 AGGAAGCCCCCCGAACCCGCAGG + Intergenic
985073503 4:186191254-186191276 AGGACGCGCCCCGCCTCCCGGGG + Intergenic
985731709 5:1553218-1553240 AAGAGGCGCCCCGAACCCGGAGG + Intergenic
992233416 5:74685100-74685122 AGGACGCTCCCGGGGCCTGGAGG + Intronic
1002400902 5:178991163-178991185 AGGTCCCTCCCCGCACCCCCAGG + Intronic
1002526803 5:179819711-179819733 AGGCCTCTCCCTGCATCCGGCGG - Intronic
1007736350 6:43984694-43984716 AGGACTCTCCCTTCACCCAGAGG + Intergenic
1021101107 7:16586613-16586635 AGCCCGCTCCCCGCAGCCGAAGG + Intergenic
1029205944 7:98869550-98869572 AGGGGGCTCCCCGCACCCCCTGG - Intronic
1037262927 8:17027602-17027624 AGGACCCGCCCCGCGGCCGGGGG + Exonic
1039979219 8:42392136-42392158 AGGTCGCTGCCCGCGCCCGGAGG - Intronic
1040291909 8:46129847-46129869 AGAACACTCCCTGCACCCAGGGG - Intergenic
1049591153 8:143463339-143463361 CAGATGCTCCCAGCACCCGGCGG - Intronic
1050151418 9:2622279-2622301 AGGACGCGCCCCTCCGCCGGCGG + Intronic
1055357687 9:75454246-75454268 AGGACGTTCACCCCACCCTGGGG - Intergenic
1061680928 9:132242123-132242145 AGGACGCTCCCCGCACCCGGAGG + Exonic
1062013569 9:134280136-134280158 AGACCGCTCCCCACTCCCGGGGG - Intergenic
1062266570 9:135689202-135689224 AGAGGGCTCCACGCACCCGGGGG - Intergenic
1062476168 9:136728507-136728529 AGGACGCTCCACGAGCCCGTGGG + Intergenic
1203360615 Un_KI270442v1:217421-217443 AGGGTGCTCCCAACACCCGGAGG + Intergenic