ID: 1061682708

View in Genome Browser
Species Human (GRCh38)
Location 9:132250843-132250865
Sequence GTGGCCTAGAAGGAGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061682704_1061682708 -5 Left 1061682704 9:132250825-132250847 CCCAGGCTCTGATCCTGGGTGGC No data
Right 1061682708 9:132250843-132250865 GTGGCCTAGAAGGAGTGTGCAGG No data
1061682693_1061682708 21 Left 1061682693 9:132250799-132250821 CCTGGCTTCCCCAACCAGTCACC No data
Right 1061682708 9:132250843-132250865 GTGGCCTAGAAGGAGTGTGCAGG No data
1061682705_1061682708 -6 Left 1061682705 9:132250826-132250848 CCAGGCTCTGATCCTGGGTGGCC No data
Right 1061682708 9:132250843-132250865 GTGGCCTAGAAGGAGTGTGCAGG No data
1061682698_1061682708 7 Left 1061682698 9:132250813-132250835 CCAGTCACCCTACCCAGGCTCTG No data
Right 1061682708 9:132250843-132250865 GTGGCCTAGAAGGAGTGTGCAGG No data
1061682694_1061682708 13 Left 1061682694 9:132250807-132250829 CCCCAACCAGTCACCCTACCCAG No data
Right 1061682708 9:132250843-132250865 GTGGCCTAGAAGGAGTGTGCAGG No data
1061682701_1061682708 -1 Left 1061682701 9:132250821-132250843 CCTACCCAGGCTCTGATCCTGGG No data
Right 1061682708 9:132250843-132250865 GTGGCCTAGAAGGAGTGTGCAGG No data
1061682697_1061682708 11 Left 1061682697 9:132250809-132250831 CCAACCAGTCACCCTACCCAGGC No data
Right 1061682708 9:132250843-132250865 GTGGCCTAGAAGGAGTGTGCAGG No data
1061682695_1061682708 12 Left 1061682695 9:132250808-132250830 CCCAACCAGTCACCCTACCCAGG No data
Right 1061682708 9:132250843-132250865 GTGGCCTAGAAGGAGTGTGCAGG No data
1061682699_1061682708 0 Left 1061682699 9:132250820-132250842 CCCTACCCAGGCTCTGATCCTGG No data
Right 1061682708 9:132250843-132250865 GTGGCCTAGAAGGAGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061682708 Original CRISPR GTGGCCTAGAAGGAGTGTGC AGG Intergenic
No off target data available for this crispr