ID: 1061683508

View in Genome Browser
Species Human (GRCh38)
Location 9:132256768-132256790
Sequence AGGATGCTATGGCGTCTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061683508_1061683515 29 Left 1061683508 9:132256768-132256790 CCCATGAGACGCCATAGCATCCT No data
Right 1061683515 9:132256820-132256842 TATTGTCAAATGTCCCCCTGAGG No data
1061683508_1061683516 30 Left 1061683508 9:132256768-132256790 CCCATGAGACGCCATAGCATCCT No data
Right 1061683516 9:132256821-132256843 ATTGTCAAATGTCCCCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061683508 Original CRISPR AGGATGCTATGGCGTCTCAT GGG (reversed) Intergenic