ID: 1061683515

View in Genome Browser
Species Human (GRCh38)
Location 9:132256820-132256842
Sequence TATTGTCAAATGTCCCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061683514_1061683515 -6 Left 1061683514 9:132256803-132256825 CCACAGATGTCTCTACATATTGT No data
Right 1061683515 9:132256820-132256842 TATTGTCAAATGTCCCCCTGAGG No data
1061683508_1061683515 29 Left 1061683508 9:132256768-132256790 CCCATGAGACGCCATAGCATCCT No data
Right 1061683515 9:132256820-132256842 TATTGTCAAATGTCCCCCTGAGG No data
1061683510_1061683515 18 Left 1061683510 9:132256779-132256801 CCATAGCATCCTCCCGTGTGACA No data
Right 1061683515 9:132256820-132256842 TATTGTCAAATGTCCCCCTGAGG No data
1061683511_1061683515 9 Left 1061683511 9:132256788-132256810 CCTCCCGTGTGACAACCACAGAT No data
Right 1061683515 9:132256820-132256842 TATTGTCAAATGTCCCCCTGAGG No data
1061683513_1061683515 5 Left 1061683513 9:132256792-132256814 CCGTGTGACAACCACAGATGTCT No data
Right 1061683515 9:132256820-132256842 TATTGTCAAATGTCCCCCTGAGG No data
1061683509_1061683515 28 Left 1061683509 9:132256769-132256791 CCATGAGACGCCATAGCATCCTC No data
Right 1061683515 9:132256820-132256842 TATTGTCAAATGTCCCCCTGAGG No data
1061683512_1061683515 6 Left 1061683512 9:132256791-132256813 CCCGTGTGACAACCACAGATGTC No data
Right 1061683515 9:132256820-132256842 TATTGTCAAATGTCCCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061683515 Original CRISPR TATTGTCAAATGTCCCCCTG AGG Intergenic