ID: 1061687811

View in Genome Browser
Species Human (GRCh38)
Location 9:132296882-132296904
Sequence TATCGTCTACTGACAGAGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061687811_1061687817 19 Left 1061687811 9:132296882-132296904 CCTACCTCTGTCAGTAGACGATA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1061687817 9:132296924-132296946 TTTGATTTTCCTGTTCCAGGTGG 0: 1
1: 0
2: 1
3: 39
4: 374
1061687811_1061687816 16 Left 1061687811 9:132296882-132296904 CCTACCTCTGTCAGTAGACGATA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1061687816 9:132296921-132296943 GTTTTTGATTTTCCTGTTCCAGG 0: 1
1: 0
2: 1
3: 48
4: 588

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061687811 Original CRISPR TATCGTCTACTGACAGAGGT AGG (reversed) Exonic
900656869 1:3762894-3762916 TGCAGTCTACTGACAGAGGGAGG + Intronic
904305559 1:29586413-29586435 CAGCTTCTACTGACAGAGGGTGG - Intergenic
905503056 1:38454588-38454610 TGTCGCCTACTGACAGAGAAGGG + Intergenic
908426270 1:64010624-64010646 TATTGTCTACTGACATAGTTTGG + Intronic
915641343 1:157229507-157229529 TATCGTCTTCTCAAGGAGGTCGG + Intergenic
918170463 1:181991642-181991664 TTTCGTGTACTGACACATGTGGG + Intergenic
922310803 1:224388359-224388381 TATCCTCTACTGAAAAAGGGAGG + Exonic
1063434364 10:6018462-6018484 TAACATCTCCTGAAAGAGGTCGG + Intronic
1080546146 11:33320752-33320774 TGTCGTTTACTGACATGGGTAGG + Intronic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1087472567 11:98595736-98595758 TATGGTCTACTGACAAAGCGAGG - Intergenic
1096239802 12:49953744-49953766 GATGGTCTACAGACAGAGGAAGG + Intronic
1101399159 12:104373164-104373186 TCTCCTCTCCTGACAGAGGCCGG - Intergenic
1108226217 13:48292417-48292439 TGTAGTCTACAGACAGATGTTGG + Intergenic
1110999629 13:82163698-82163720 TTTCATCTACTGAAAAAGGTTGG + Intergenic
1114960728 14:27885123-27885145 TACCCTCTGCTCACAGAGGTGGG + Intergenic
1118037149 14:61880060-61880082 TTTCATCTGCAGACAGAGGTGGG - Intergenic
1130432080 15:83858832-83858854 TAAATTCTACTTACAGAGGTGGG - Exonic
1136151866 16:28356522-28356544 CAGCGTCTACTCACAGGGGTGGG + Intronic
1136168100 16:28470359-28470381 CAGCGTCTACTCACAGGGGTGGG + Intronic
1136194872 16:28644647-28644669 CAGCGTCTACTCACAGGGGTGGG - Intronic
1136211213 16:28758761-28758783 CAGCGTCTACTCACAGGGGTGGG - Intronic
1136255935 16:29038712-29038734 CAGCGTCTACTCACAGGGGTGGG - Exonic
1139857086 16:69989942-69989964 CAGCGTCTACTCACAGGGGTGGG + Intergenic
1140192624 16:72830918-72830940 TCTGGTCTGCTGACAGATGTGGG - Intronic
1140365624 16:74378031-74378053 CAGCGTCTACTCACAGGGGTGGG - Exonic
1146433459 17:32821505-32821527 TATCTTCAGCTGACAAAGGTTGG - Intronic
939718927 2:145622791-145622813 TATATTCTACTGAGAGAGGCAGG - Intergenic
948350040 2:237332583-237332605 TATCGTCTACTGTCAGGAGGAGG - Intronic
953982903 3:47421537-47421559 TTTTGTCTGCTGACAGAGCTTGG - Intronic
955906082 3:63809099-63809121 TATCTTCTACTTCCAAAGGTGGG + Intergenic
956072608 3:65470350-65470372 TATCCTCTGCAGAAAGAGGTAGG + Exonic
958194396 3:90224306-90224328 TATCTTCTAATGATAGAGATGGG - Intergenic
958417759 3:93895353-93895375 TATCTTCTAATGATAGAGATTGG - Intronic
961842347 3:129725900-129725922 TTTAGTCTACTGCCAAAGGTAGG + Intronic
962149138 3:132873949-132873971 TATCATCATCTGACAGAGTTTGG + Intergenic
980135522 4:128855189-128855211 TCTACTTTACTGACAGAGGTGGG - Intronic
980595699 4:134952291-134952313 TATAGTCTCCTTCCAGAGGTCGG + Intergenic
986153380 5:5148807-5148829 TATTGTCTAATGAGAGAGGCAGG + Intronic
988390673 5:30624885-30624907 TATCGTCTAATATTAGAGGTCGG - Intergenic
992303417 5:75408712-75408734 TATTGTGTACTGGCAGAGATTGG - Intronic
996152596 5:120058185-120058207 TCTCCTCCACTGTCAGAGGTGGG - Intergenic
999099258 5:149009071-149009093 TATCTTCTACAGGCAGGGGTTGG + Intronic
1015936204 6:138407769-138407791 GCTCATGTACTGACAGAGGTCGG + Intronic
1028318992 7:89437211-89437233 TCTCGCCTACAGAGAGAGGTGGG - Intergenic
1028514663 7:91663891-91663913 TAGCATGTACAGACAGAGGTGGG - Intergenic
1044407278 8:91842733-91842755 TATCCTCTACTCTCAGAGGCAGG + Intergenic
1050698860 9:8313680-8313702 TACAGTCTACTGAGAGAGGTTGG - Intergenic
1051110882 9:13634386-13634408 TATCATTTACTGAAAGAAGTTGG - Intergenic
1061687811 9:132296882-132296904 TATCGTCTACTGACAGAGGTAGG - Exonic
1190816049 X:53930733-53930755 TTCCGTCTACTGACTGATGTAGG - Intergenic
1191706507 X:64099728-64099750 TATCCTTTACTGACAGCAGTGGG + Intergenic
1200297058 X:154930820-154930842 TATCGTCAACAGAGAGTGGTAGG - Exonic