ID: 1061689645

View in Genome Browser
Species Human (GRCh38)
Location 9:132315814-132315836
Sequence AAGGAGAAATCAAATGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 0, 2: 6, 3: 54, 4: 544}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061689645_1061689651 16 Left 1061689645 9:132315814-132315836 CCCTCATCATTTGATTTCTCCTT 0: 1
1: 0
2: 6
3: 54
4: 544
Right 1061689651 9:132315853-132315875 TCCATGACAACCTCCACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061689645 Original CRISPR AAGGAGAAATCAAATGATGA GGG (reversed) Intronic
900874082 1:5329098-5329120 AAGGAGAAAACAAATGGACATGG + Intergenic
901972169 1:12916849-12916871 AAGCAGAAATCAAAATTTGAGGG - Intronic
902013009 1:13284913-13284935 AAGCAGAAATCAAAATTTGAGGG + Intronic
903306762 1:22418374-22418396 AAGGAGGAAACCAGTGATGAAGG - Intergenic
903427036 1:23261538-23261560 AAAGAAAAAGCAAATGATGATGG - Intergenic
903683432 1:25113090-25113112 AAGGAGAAAGAAAAGGATAAGGG - Intergenic
903731603 1:25500420-25500442 AGGGAGAAAACAAATGAGAATGG - Intergenic
904513273 1:31032300-31032322 CAAGAGAAATCAAAAAATGAAGG + Intronic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
906554433 1:46696989-46697011 AGGAAGAAAGCTAATGATGAAGG + Intronic
906922593 1:50080482-50080504 TGAGAGAAATCAAATGATGATGG - Intronic
906979289 1:50611589-50611611 AAGGAAACATGAGATGATGATGG + Intronic
908284400 1:62578890-62578912 AAGTAAAAAGCAAGTGATGATGG + Exonic
908312878 1:62903081-62903103 AGGGAGAAAGCAAATGAAGATGG - Intergenic
908456793 1:64312143-64312165 AAGTAGAAAACAAATAATTAGGG + Intergenic
910594148 1:88960477-88960499 AAGGACAAAGCAAATGCTGGAGG + Intronic
911265638 1:95740123-95740145 AAGAAGAAAACAAATAAGGAAGG - Intergenic
911389358 1:97219633-97219655 GAGGAGAATTAAAATTATGAAGG + Intronic
911428584 1:97754586-97754608 AAGAAGAAAACAAAGAATGAAGG - Intronic
912168267 1:107066354-107066376 GATGAGAAAACAAAGGATGAAGG + Intergenic
913156274 1:116102412-116102434 AGGCAGAAATCAAGTCATGAAGG + Intergenic
913588136 1:120296630-120296652 TAGCAGAAATCAAATGAAGGTGG + Intergenic
913620049 1:120601739-120601761 TAGCAGAAATCAAATGAAGGTGG - Intergenic
913698215 1:121348201-121348223 AAGGATAAATGAGATGAGGATGG - Intronic
914139334 1:144931851-144931873 AAGGATAAATGAGATGAGGATGG + Intronic
914256658 1:145965457-145965479 AAGGAGAACTGGAATGGTGAGGG + Intronic
914570153 1:148908503-148908525 TAGCAGAAATCAAATGAAGGCGG + Intronic
914602675 1:149221766-149221788 TAGCAGAAATCAAATGAAGGCGG - Intergenic
915023878 1:152807885-152807907 AGTGAGAATTCCAATGATGATGG - Intronic
916506274 1:165430653-165430675 AAGGAGAAAACACATGCTGTGGG + Intronic
916764559 1:167847807-167847829 AAACAGAAACCAAATAATGAGGG - Intronic
917412998 1:174779633-174779655 AAGCAGAAATCAAATCTTTAGGG - Intronic
917518407 1:175727895-175727917 AAGGAGAAATAAAATTGTGGAGG + Intronic
917628303 1:176867989-176868011 AATGAGAAAGAAAATGAAGAAGG - Intronic
917678201 1:177340229-177340251 AGGGAGAAATAAAAAGAGGAGGG + Intergenic
919021726 1:192114662-192114684 AAGGAGAAAAGAAAAAATGAGGG + Intergenic
919183927 1:194120009-194120031 AGAGAGAAATGAAATGAAGATGG + Intergenic
919364122 1:196635311-196635333 AAGGAGAAATTAAAAAACGAAGG + Intergenic
919798089 1:201333303-201333325 AAAGAGAAATTCAAAGATGAAGG + Intergenic
919977344 1:202621259-202621281 AAGGAGAAAACAAATGAGGGGGG + Intronic
920485614 1:206366857-206366879 AAGGATAAATGAGATGAGGATGG - Intronic
924262183 1:242243353-242243375 AAGAACAAATTAAATGAGGAGGG + Intronic
1063789028 10:9419910-9419932 AAGGAGAAATTACATGAGGCTGG + Intergenic
1064156433 10:12906748-12906770 AAGATGAAATCAGATGATAAGGG + Intronic
1065602929 10:27388102-27388124 AGGGAGAAATAAAAAGAGGAGGG + Intergenic
1065658653 10:27981563-27981585 AAGGGCAAAACAGATGATGAAGG - Exonic
1066533181 10:36362708-36362730 AAGGAAAAATAAAAGGGTGACGG - Intergenic
1067706303 10:48608685-48608707 AAGGAGAAACCAAAGTATGAGGG - Intronic
1068496535 10:57790626-57790648 AAGGAAAAAGAAAATGAGGAAGG + Intergenic
1068950468 10:62771410-62771432 AAGAAGAAATCAAATTATGAGGG - Intergenic
1069584843 10:69592369-69592391 AAGGATTGATCAAATGAAGAGGG + Intergenic
1071089216 10:81899462-81899484 AAAGAGAAATGGAATCATGATGG - Intronic
1071220005 10:83454927-83454949 AAGGAGAAAACAAGTTAAGAAGG + Intergenic
1072940551 10:99759983-99760005 AAGGAGAAATCAAAGAAAGGGGG + Intergenic
1073265650 10:102226841-102226863 AAGCAGAAATAAGAGGATGAGGG + Intronic
1073339783 10:102735831-102735853 AAGGAGAAACCAAAGCATCAGGG - Intronic
1073633518 10:105173696-105173718 AGGCAGAAGTCAAATCATGAAGG - Intronic
1074299385 10:112219474-112219496 AAAGGGAAATCAAATGAAGTTGG - Intergenic
1074363004 10:112837940-112837962 AAGGATTAATCAGATGATGCAGG - Intergenic
1075298356 10:121297882-121297904 GAGGTGAAATCAAAGGATGGAGG + Intergenic
1077372768 11:2191242-2191264 AGGGAGAAAGCAAAGGAGGAAGG + Intergenic
1079134646 11:17769503-17769525 AAGGAGAAAGGAAAGGAGGAAGG + Intronic
1079961893 11:26934514-26934536 AATGAGAAAGCTAATGAAGATGG - Intergenic
1080267526 11:30417272-30417294 AGGGAAAAATCAAATGAGTATGG - Intronic
1080340070 11:31251941-31251963 ATGAAGAAACCAAATCATGAAGG + Intronic
1081331120 11:41801332-41801354 AAGGAGAAAACAAATGTGGGTGG - Intergenic
1082245103 11:49912335-49912357 AAGGAGAAATTAAATGCTGCTGG + Intergenic
1082664675 11:55960930-55960952 AGGGAGAAATCCAACTATGAAGG + Intergenic
1083834780 11:65259034-65259056 AAAGAGAAATGAAATGAAAAGGG - Intergenic
1083977643 11:66136516-66136538 GAGAATAAATCAAATAATGATGG - Intronic
1084765177 11:71303680-71303702 AAGGGGACATGAAATGATGGTGG - Intergenic
1085665699 11:78414184-78414206 AAGGAAAATTGAAATGATGAGGG - Intronic
1085676293 11:78521899-78521921 AAAGAGAATTAAAATGATAAAGG + Intronic
1086379250 11:86235092-86235114 AAGGAGAAAGGAAAAGAAGAAGG + Intergenic
1087113451 11:94496700-94496722 AAAGAAAAAGGAAATGATGATGG + Exonic
1087514156 11:99136078-99136100 AAGGAGAAATGACAAGAAGAAGG - Intronic
1087575978 11:99990178-99990200 AAGGAGCCCTCAAATGATGGTGG + Intronic
1087635732 11:100699004-100699026 AAGAAGAAATAAAATGAAAATGG - Intronic
1087730777 11:101776146-101776168 AAGTAGAAATCAAGACATGAAGG + Intronic
1087937703 11:104054608-104054630 GGGGAGAAAACAAATGAAGATGG + Intronic
1087966984 11:104427865-104427887 AAAGAAAAATAAAATGATCATGG - Intergenic
1087967496 11:104435941-104435963 AAAAAGAATTTAAATGATGAGGG + Intergenic
1087978819 11:104584864-104584886 AGGGACAAATCAAATAAGGAGGG - Intergenic
1088046148 11:105454058-105454080 TAGGAAAAATCAAATGAATATGG + Intergenic
1088717091 11:112558449-112558471 AAAGAGATATGAAATGGTGAAGG - Intergenic
1088735805 11:112726840-112726862 AAGGAGAAATCAAATGTGCATGG - Intergenic
1088865155 11:113840310-113840332 AAGGAGGAATCAGTTGTTGAAGG - Intronic
1089233292 11:116999724-116999746 AGGGAGAAAACAAATGAAAATGG - Intronic
1089640010 11:119841750-119841772 CAGGAGAACTCAATTGATGACGG - Intergenic
1090200959 11:124855830-124855852 AAGGAGAAAGCAAGTGAAGGAGG - Intergenic
1090214757 11:124952051-124952073 CAGGAGAAAACTAATGATGCGGG - Intergenic
1091105062 11:132910637-132910659 AAGAAGAAACCAGGTGATGAAGG - Intronic
1091658220 12:2361482-2361504 AAGGAGAAATGAAGGGAGGAAGG - Intronic
1092033475 12:5309631-5309653 AAGGAGGAGTCAAAAGGTGAGGG - Intergenic
1092312950 12:7377998-7378020 AAGCAGTCATCAAATGAAGAGGG - Intronic
1092443308 12:8528139-8528161 AAGAAGCAATCAGATAATGAGGG + Intergenic
1092929199 12:13299309-13299331 AAGGTGAACTCAAATGGTTAGGG + Intergenic
1093131991 12:15403047-15403069 AATAAGAAATCAAATGTTTATGG - Intronic
1093198030 12:16151963-16151985 AAGGAGAAAGCAAAAGACGGAGG - Intergenic
1093680534 12:21997016-21997038 AGGAAAAAATTAAATGATGAGGG + Intergenic
1094001242 12:25696914-25696936 CAGCAAAAATCAAATGGTGAAGG - Intergenic
1094113529 12:26885603-26885625 AAGGAGTAAGCAAATGATTCAGG - Intergenic
1094219528 12:27976537-27976559 AAGGAGAAAACAAATGCTATGGG + Intergenic
1094390654 12:29946560-29946582 ATAGAGAAATCACCTGATGATGG + Intergenic
1094848128 12:34370366-34370388 AAGGAAAACACAAATGGTGAGGG - Intergenic
1095180295 12:39140094-39140116 AAGGGGAAAAATAATGATGAAGG - Intergenic
1097356286 12:58605815-58605837 AAGGAGAAATGAAAGAAGGAAGG - Intronic
1097772317 12:63602303-63602325 AAGAAAAATTCAAATAATGAAGG + Intronic
1097935702 12:65248490-65248512 AAGGAAAAATAAAATGCTGAGGG - Intergenic
1098050638 12:66448924-66448946 CAGGAGAAAGGAACTGATGAAGG - Intronic
1099124765 12:78739710-78739732 AAGGAGAAAGAAAAAAATGAAGG + Intergenic
1099131546 12:78839658-78839680 AAGAAGAAATTAAACGAAGAGGG + Intergenic
1099341966 12:81448836-81448858 AAGGAGATATCCAATGTTGTAGG - Intronic
1100169650 12:91959666-91959688 AAGGAGAATTCTAATGATCTGGG + Intergenic
1100169829 12:91961474-91961496 AAGGAGAAATCAAATGCACAAGG + Intergenic
1100230558 12:92602235-92602257 AACTAGAGACCAAATGATGATGG - Intergenic
1100412767 12:94338675-94338697 AGGGAGAAATCAGAGGGTGAAGG + Intronic
1100563431 12:95771828-95771850 AATCAGATAACAAATGATGATGG - Intronic
1100645706 12:96528003-96528025 AAAGAGAAATTAAAAGATTAAGG - Intronic
1100774278 12:97957210-97957232 AATGAGAAATCAGATGGAGAGGG + Intergenic
1101053408 12:100887488-100887510 AAGGAGAAACCAAATGACCCTGG + Intronic
1101500076 12:105295592-105295614 AAGCAGAGAAGAAATGATGAGGG - Intronic
1102833706 12:116032898-116032920 AAGGAGAAAGGAAAAGAAGACGG + Intronic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1104212360 12:126701449-126701471 AAGGAGTTAGAAAATGATGATGG + Intergenic
1104425636 12:128675195-128675217 AAGGAAAAAGCAGATGAAGAAGG + Intronic
1104631078 12:130402592-130402614 AAGCAGAGATCAAATTATGGAGG - Intronic
1105601658 13:21893224-21893246 AAGGGAAAATCAAGTGATGGTGG + Intergenic
1106151861 13:27112267-27112289 AAGTAGCTATGAAATGATGAAGG - Intronic
1106190330 13:27447000-27447022 AAGAATAAAACAAATGGTGATGG + Intronic
1106203618 13:27567232-27567254 AAGGATAAATCCAACAATGAAGG + Intronic
1106609245 13:31262815-31262837 AAGTAGAGATCAAATGAGGAAGG - Intronic
1107617877 13:42190483-42190505 AAGGAGGAAGCTAAAGATGATGG + Exonic
1107759586 13:43663277-43663299 AGGCAGAAATCAAATCTTGAAGG - Intronic
1107998738 13:45887578-45887600 AGAGAGAAATAAAATGATGATGG + Intergenic
1108006508 13:45952351-45952373 AAGGAGAAATAAATGGATAAGGG + Intergenic
1108781152 13:53835784-53835806 AAGGACTAATGAAAAGATGAAGG - Intergenic
1109461557 13:62666010-62666032 AAGGTGAAATAAATTGATCATGG + Intergenic
1109693215 13:65920302-65920324 AAAGATATATCAAATGATGTAGG - Intergenic
1111228266 13:85305060-85305082 GAGGAGAAATTATATAATGAAGG - Intergenic
1111506152 13:89191600-89191622 AAGGAGAAATAAAGAGAAGATGG + Intergenic
1111674283 13:91367760-91367782 ACTGAGAAATCTAATCATGATGG - Intergenic
1112171831 13:96980865-96980887 AAGTAGAAATGAAAAGATAATGG + Intergenic
1112247441 13:97747676-97747698 AAGGAGCAAACAAACGATTAGGG + Intergenic
1112384201 13:98922615-98922637 AAGGAGAGATAAAGTGATGGGGG + Intronic
1112809716 13:103203676-103203698 AGGGAAAAAAAAAATGATGACGG - Intergenic
1113230023 13:108203147-108203169 AACGAGGAACCAAATGATAATGG - Intergenic
1115066662 14:29270153-29270175 TAGGTGAAGTGAAATGATGATGG + Intergenic
1115571418 14:34670321-34670343 AATGAGAACTCATCTGATGATGG - Intergenic
1115714765 14:36091114-36091136 ATGGAGTAAACAAATGAAGAGGG - Intergenic
1116065510 14:39977225-39977247 CAGGAGAAATCTATTGTTGAAGG - Intergenic
1116863582 14:50013763-50013785 AAGAAGAAAAGAAATGACGAAGG + Intergenic
1117300351 14:54419754-54419776 AAGGTGAAATGAAATGTAGATGG - Intronic
1117705034 14:58456970-58456992 AAGTAGAAATCACTTGGTGAAGG - Intronic
1118504438 14:66395449-66395471 AACCAGAAATCAAATGATGCTGG - Intergenic
1118612724 14:67554117-67554139 AAGGAGAAAAAAATGGATGAGGG + Intronic
1120000283 14:79295155-79295177 AAGGAAAAAGAAAAAGATGAAGG - Intronic
1120329618 14:83074698-83074720 AAGAAGAAAACAAATAATTATGG + Intergenic
1120347055 14:83303889-83303911 AAGAAGTGTTCAAATGATGATGG + Intergenic
1121448609 14:93993933-93993955 AAGAAGAAAAGAAATGATCAAGG - Intergenic
1121883159 14:97518242-97518264 AAGGAGAAAGCAGTTGCTGAAGG - Intergenic
1123896201 15:24832800-24832822 ACGTAGAACTCAAAAGATGATGG + Intronic
1124037831 15:26072632-26072654 ATGGATAAATAAAAAGATGATGG - Intergenic
1124493003 15:30169640-30169662 AAGGAGAAAACAAACGAGGGGGG + Intergenic
1124750531 15:32368685-32368707 AAGGAGAAAACAAATGAGGGGGG - Intergenic
1125067291 15:35503532-35503554 AATGAGAAATGGAATGATAAAGG - Intronic
1125686602 15:41567329-41567351 AAGCAGAAAACTAATGATGTAGG - Intronic
1126261083 15:46692363-46692385 AAGAAGAAATCAAAAGATTTGGG + Intergenic
1126685115 15:51241608-51241630 GAGGAGAAATCCAGTGAGGAAGG + Intronic
1126822789 15:52521326-52521348 TAGGAGAAGTAAAATGATCAGGG - Intronic
1127142483 15:55992257-55992279 GAAGAGAAATAAAGTGATGATGG - Intronic
1127360692 15:58242476-58242498 AATGAGAAAAAAAATGATGATGG + Intronic
1127485705 15:59415884-59415906 AAGCAGAAATGAACTGATTAAGG + Intronic
1127662673 15:61114910-61114932 AAGCATAACTCTAATGATGAGGG - Intronic
1127761115 15:62139985-62140007 AAGGTGAAGACAAATGCTGAGGG - Intergenic
1127795720 15:62436701-62436723 AAAGAGAAATCAAAGAATCATGG - Intronic
1129111071 15:73337562-73337584 AAGGAGTAATGAAAAGATAAAGG - Intronic
1129880974 15:79005813-79005835 AAAGAGAAAGGAAATGAGGAGGG - Intronic
1130135108 15:81175923-81175945 AATGCAAAAACAAATGATGAAGG + Intronic
1132169319 15:99631773-99631795 ATGAAGAAATAAAATAATGAGGG + Intronic
1133434143 16:5764789-5764811 AATGATAAAAAAAATGATGATGG - Intergenic
1133652875 16:7829525-7829547 AAGGAGAAATTGGATGATGGAGG - Intergenic
1133697501 16:8278824-8278846 ACGGAGAAATCCACTGAAGAGGG - Intergenic
1134291726 16:12907069-12907091 AAGGAAAAAACAAAGGAGGAAGG - Intronic
1134627741 16:15734877-15734899 GATGAGAAATAAGATGATGAGGG + Intronic
1135484815 16:22855066-22855088 AAGTAGAAAGCAAATGCTGTTGG + Intronic
1135892631 16:26371420-26371442 AAGGAAAGATAAAATGAGGAGGG + Intergenic
1136086161 16:27886672-27886694 AGGGAGAAATGAAATTGTGAGGG + Intronic
1136629465 16:31481072-31481094 AAGGAGATGTCACATCATGAAGG + Intergenic
1137887153 16:52118001-52118023 GAGGACAAAACAAATGATAAAGG - Intergenic
1140782538 16:78309753-78309775 TAAGAGAAATGAAAGGATGATGG + Intronic
1141409224 16:83821173-83821195 AGTGAGAAATCAAAGTATGAAGG + Intergenic
1142626257 17:1194095-1194117 AAGGAGAAATCAAAAGACCCAGG - Intronic
1143037182 17:4006011-4006033 AAGCAGAAATAAAATTATGTGGG + Exonic
1143495999 17:7312927-7312949 AAGGAAAAACCAGATGATGTGGG + Intronic
1144444604 17:15315291-15315313 AAGGAGGAATCAGATCATGCAGG + Intronic
1144461527 17:15462464-15462486 AAGTAGAAGTCAAACCATGAAGG + Intronic
1144664475 17:17092548-17092570 AAGGAGAAAGAAAAGGATGAGGG - Intronic
1147210936 17:38872047-38872069 AAGGAAAAAGCAAAACATGAAGG + Intronic
1147632522 17:41941284-41941306 CAGGAGAAGTCAAGTGAAGAAGG - Intronic
1148290443 17:46443550-46443572 AAAGAAAAAACAAATGATAAAGG - Intergenic
1148312611 17:46661123-46661145 AAAGAAAAAACAAATGATAAAGG - Intronic
1149000855 17:51756229-51756251 AGGGTGAAATGAGATGATGATGG - Intronic
1149941037 17:60866764-60866786 AAGGAACAAACAAATAATGAAGG - Intronic
1150980382 17:70134977-70134999 AAGGAGAAAGGGAAGGATGAGGG - Exonic
1152166220 17:78708854-78708876 AAGCAGAAATCAAAGGATCAGGG + Intronic
1152999760 18:443682-443704 AAGGAGAAAGCAAAGAATAAAGG + Intronic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1155238291 18:23843156-23843178 AAGGAGAAATGACACAATGAGGG - Intronic
1156012434 18:32510918-32510940 AAGTAGAAGTCAGATCATGAAGG - Intergenic
1156039337 18:32802705-32802727 AAGCAGAAATCTAAGGAAGAAGG - Intergenic
1156046764 18:32886079-32886101 AAGTATAAAACAAATGAAGAGGG + Intergenic
1156119562 18:33825561-33825583 AAGGACAAATCAAATGGATACGG + Intergenic
1156609274 18:38707368-38707390 AACCAGAAACCAAATGCTGATGG + Intergenic
1156771340 18:40730435-40730457 AAGGAGAAATCTCAGAATGAAGG - Intergenic
1157060890 18:44289003-44289025 AAGGAGACATGAAAGTATGAAGG + Intergenic
1157772482 18:50361396-50361418 CAGAAGATAGCAAATGATGATGG - Intergenic
1157800928 18:50620512-50620534 AAGCAGAAAGTAAATGTTGATGG - Intronic
1158475531 18:57776077-57776099 AAGCAGCCAACAAATGATGATGG - Intronic
1158715344 18:59874312-59874334 AAGGAGAAATTACATCATGCTGG + Intergenic
1158740204 18:60133219-60133241 AAGCTGAAATAAAATGTTGAAGG + Intergenic
1159349698 18:67256584-67256606 AAGGAGGGGTCAAATTATGATGG - Intergenic
1159688364 18:71453000-71453022 AAAGAGAAAATAAATGAAGAAGG + Intergenic
1159926502 18:74274500-74274522 AAGGAGAAAGAAAATGCTGTGGG + Intronic
1160025685 18:75213572-75213594 AAGGACAAACAAAATGCTGAGGG + Intronic
1160147158 18:76375235-76375257 AAGGAGAAAGGAAATGCGGAAGG + Intronic
1161934658 19:7364264-7364286 ATGGATAAATGAAAGGATGAAGG + Intronic
1164706544 19:30324275-30324297 AAGGATAAAAAAATTGATGATGG - Intronic
1164732726 19:30518489-30518511 AAGGAGAAGTCAGAGGATAAGGG + Intronic
1164948654 19:32317757-32317779 AAAGAAAAAGAAAATGATGATGG + Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1166915356 19:46191807-46191829 AAAGAGTAATCAAATGATGGGGG - Intergenic
1167809857 19:51819869-51819891 TAGTAGAAATCAAATCTTGAGGG + Intronic
1168460867 19:56556691-56556713 AACAAGAAAACAAATGATAAAGG + Exonic
925016807 2:534006-534028 AAAGAGAAATCACTTGAAGATGG - Intergenic
925625920 2:5842035-5842057 AAGGAGAAAAGAAAAGAAGAGGG + Intergenic
926833345 2:16989191-16989213 AGGGAGAAATCAAATAGTCAGGG - Intergenic
927417247 2:22892150-22892172 AAGGAGGCATCAAATGAGGGAGG + Intergenic
928109036 2:28491662-28491684 AAGAAGAGATAAAATGAAGAAGG - Intronic
928603632 2:32924587-32924609 AAGGAGACTTCAAGTGATGAGGG + Intergenic
928620012 2:33079248-33079270 ATGGAGAAAACAAATGAATAAGG + Intronic
929022433 2:37566733-37566755 AAAAAGAAATCAAATCATGGAGG - Intergenic
929486977 2:42363337-42363359 AAAGAGAAATTAAATGATTTGGG + Intronic
929728379 2:44457787-44457809 AAGAAGAAAACAAATATTGAGGG - Intronic
930646292 2:53912372-53912394 AAGAAGAGATCAAATTATGGTGG - Intronic
930662860 2:54072546-54072568 AAGAAGAAAGAAAATAATGAAGG - Intronic
931066660 2:58595417-58595439 AAGGAGAACTCAAGAGGTGATGG + Intergenic
931173528 2:59830132-59830154 GAGGAGAAATAAAATGTTAAGGG - Intergenic
931588825 2:63858260-63858282 AATGAGAAATCAAATGTTTTGGG - Intronic
932115633 2:69044240-69044262 AAGGAGAAATTAAAAGTTGATGG + Intronic
932431443 2:71676769-71676791 AATTAGAAAACAAATTATGAAGG - Intronic
933564589 2:83934665-83934687 AAGGAGAAATGCGTTGATGAGGG + Intergenic
933881536 2:86674606-86674628 AAGAAGAAATCAAATCAAAATGG + Intronic
934085928 2:88509580-88509602 ATGGAGCACTCAAAGGATGAGGG + Intergenic
935607954 2:104989755-104989777 GAAGAAAAATGAAATGATGAGGG + Intergenic
936099622 2:109564049-109564071 AAAAAGAAATCAAATAATGAGGG + Intronic
936433751 2:112485466-112485488 AAGGAGAACTAGAATGATGCTGG - Intronic
939361598 2:141179630-141179652 AAGGAAAAGGCAAATGTTGAAGG - Intronic
939448650 2:142342427-142342449 AAGGATAAATGAAATCATAAAGG + Intergenic
940066608 2:149637099-149637121 AAGGAGAAATCAATTGTTGTGGG - Intergenic
941006505 2:160252525-160252547 AAGGAGAACTCTAAAGAGGAAGG + Intronic
941173286 2:162165557-162165579 AATGTGAAATCCAATGATCAGGG + Intergenic
941848613 2:170157105-170157127 AGAGAGGAATCCAATGATGAGGG - Intergenic
942296625 2:174523816-174523838 AAGGAAAAAACAAATCAGGAAGG - Intergenic
942434227 2:175953909-175953931 AAGGAGGGATCAAATTATGAAGG - Intronic
945503227 2:210604620-210604642 GAGGAGAAAGGAGATGATGATGG - Intronic
945632401 2:212296906-212296928 AAGGAGAGTTGAAATCATGAAGG - Intronic
945763838 2:213948367-213948389 GAGGAGAAGTCAAATTTTGATGG - Intronic
945786255 2:214241608-214241630 AAATAGAAATAAATTGATGATGG + Intronic
945890531 2:215426014-215426036 GAGGAGAAATAAAATGTGGAAGG - Intronic
946914228 2:224500072-224500094 AAAGAGAAAGTAAATGATGATGG - Intronic
947708210 2:232293428-232293450 AAGGGGAAAACAAAAGATCAGGG + Intronic
948008392 2:234630473-234630495 AAAGTGAAATCGCATGATGAGGG + Intergenic
948732038 2:239971464-239971486 AAAGAAAAGTCAAAGGATGAAGG - Intronic
1169570021 20:6896221-6896243 AGGGAGTATTCAAATGAAGAAGG + Intergenic
1169768637 20:9177076-9177098 AATAAGGAATCAAATGAAGATGG + Intronic
1170034984 20:11980699-11980721 TGGGAGAATTCAAATGTTGAGGG + Intergenic
1170674339 20:18465642-18465664 AAGGACAAATTAAATGAGTAAGG + Intronic
1172245294 20:33441921-33441943 AAGGAGAAATGAGAAAATGAGGG - Intronic
1173871837 20:46347074-46347096 AAGGTGAAATAAAATAATGTAGG - Intronic
1174716812 20:52767584-52767606 AAGGAGAACTAAAGTGAGGATGG - Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175287694 20:57848717-57848739 AGGGAGAAAGGAAATGAGGAAGG - Intergenic
1176593323 21:8664338-8664360 ATGTTGAAATGAAATGATGAAGG + Intergenic
1177144976 21:17397734-17397756 AAGGAGAAAGGAAGGGATGAAGG + Intergenic
1177338524 21:19765114-19765136 CAGAAGAAATTAAAGGATGAAGG + Intergenic
1177947048 21:27483444-27483466 TAGGAGAAATCCAAAGAAGAAGG + Intergenic
1178552074 21:33549646-33549668 AAGACGAAATCTCATGATGATGG + Exonic
1178675908 21:34631534-34631556 GAGGAGAATTCCTATGATGAAGG + Intergenic
1179186194 21:39086945-39086967 AAGGAGAAATGAAATGAGAAGGG + Intergenic
1179355992 21:40660304-40660326 AAGAAGAAATCAAAGGAGGAGGG + Intronic
1179565239 21:42243590-42243612 GGGGATAAATCAGATGATGATGG - Intronic
1180520080 22:16189986-16190008 AATGAAAAATAAAATGCTGAAGG + Intergenic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1182047870 22:27289731-27289753 AAGGAGACATGAATTGATGCTGG - Intergenic
1182100792 22:27656031-27656053 AAGAAGGGATTAAATGATGATGG + Intergenic
1182157953 22:28093462-28093484 TAGGGGAAATCAAAGGAAGAGGG - Intronic
1182384664 22:29927631-29927653 AAAGAGAACTCAAATACTGATGG + Intronic
1182665116 22:31952482-31952504 AAGGAAACATGAAATGAAGATGG - Intronic
1183642337 22:39100237-39100259 AAGGGGAAAACCAAAGATGAAGG - Intronic
949146327 3:704811-704833 AATGACAAATGAAATTATGAAGG + Intergenic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
949311327 3:2701741-2701763 AAAGAGAAATCACAAGATGAGGG - Intronic
949389821 3:3547264-3547286 AAAGAGAAAAATAATGATGAGGG - Intergenic
949619156 3:5790503-5790525 AAGGAGGAGTCAAATGATATAGG + Intergenic
951205500 3:19922170-19922192 AAAGAAAAATAAAATTATGAAGG + Intronic
951445178 3:22771063-22771085 AATGAGAAATAAAATCATGGTGG + Intergenic
952049532 3:29366790-29366812 AAAGAGGAATAAAATGATGCAGG - Intronic
952636701 3:35541823-35541845 AAAGAGAAATAAACAGATGATGG + Intergenic
952647957 3:35684934-35684956 AAGCACAAATAAAATGCTGAAGG - Intronic
952856848 3:37778801-37778823 AATGAGAAAGGAAATGATAAAGG - Intronic
953835533 3:46339769-46339791 AAGGAGACCTCAGATGAAGATGG - Intergenic
954423397 3:50430636-50430658 GAGGAGGAATGTAATGATGAGGG + Intronic
954898502 3:53997832-53997854 AAGCAGAAAGCAAATGAAGCAGG + Intergenic
955189482 3:56747161-56747183 AAGTGGAAATTAAATGAAGAGGG - Intronic
955624510 3:60903175-60903197 AAGGAGATATTAAGTGATGACGG + Intronic
956034362 3:65074153-65074175 AAGGTGAAATTAAATGAGCAAGG - Intergenic
957569288 3:81925399-81925421 AGGGATAAACCAAAAGATGAAGG + Intergenic
957962341 3:87272834-87272856 CAGAAGAAATATAATGATGAGGG + Intronic
959084738 3:101839764-101839786 AAGGAGAAAAAAAATTTTGAAGG - Intronic
959557989 3:107745359-107745381 AAAGACAATTCAAATGATCAAGG - Intronic
960144248 3:114182587-114182609 AAGAAAAAATTAGATGATGATGG - Intronic
960222423 3:115129218-115129240 AAGTAAAAGTCAAATGATTAGGG + Intronic
960930891 3:122848514-122848536 GAGGAGAAATATAATGATCATGG - Intronic
960977893 3:123194147-123194169 TAGGAGTAATCAAATCGTGAAGG - Intronic
961027681 3:123573834-123573856 AAGGTGAAATTAAGTGATAAAGG - Intronic
961130581 3:124463040-124463062 AATGTGAAATAAAATGAGGATGG - Intronic
962062456 3:131944504-131944526 CAGGAGAAATGTAATGGTGAGGG + Intronic
962188244 3:133282665-133282687 AAGGAGAAATAAAATTATGATGG - Intronic
962334468 3:134514375-134514397 AAGGAGAAAAAAAATGAGAATGG + Intronic
962533122 3:136301959-136301981 AAAGAGAAAAAAAATGAAGATGG + Intronic
962705199 3:138036891-138036913 AAGGAGAAATGACATGCTCAAGG + Intergenic
963719044 3:148838843-148838865 AATGAGGAATCAAAAGATCAAGG - Intronic
964117161 3:153148347-153148369 AAGGAGAAATAAAAGGAGAATGG - Intergenic
964646692 3:158966038-158966060 GAGGAGAAACCACATGAAGACGG - Intronic
964755090 3:160085361-160085383 AAGATAAAATAAAATGATGAAGG - Intergenic
964982742 3:162706172-162706194 AAGGAGAAATAAAATAATGAAGG - Intergenic
965152400 3:164995563-164995585 AAGGAAAATTCAAATGCAGAAGG - Intronic
965462015 3:168977659-168977681 AAGGGAAAGTCAAATGAGGAAGG + Intergenic
966266225 3:178047721-178047743 AAGGAGAAAGGAAAGGAGGAAGG + Intergenic
967986894 3:195101917-195101939 AAGGAGAAATGTAAGGAGGAAGG + Intronic
968842517 4:3018043-3018065 AAAGAAAAAGAAAATGATGAGGG - Intronic
969288575 4:6223700-6223722 AAGGATAAATGAGATCATGAGGG - Intergenic
969528475 4:7716386-7716408 ATGGAGAAATGAACAGATGATGG - Intronic
970753277 4:19392778-19392800 AAGCAGAACTCAGATCATGAAGG + Intergenic
970917361 4:21351640-21351662 AAGGTGAAATGAGATCATGAGGG + Intronic
971103295 4:23493943-23493965 AAGAAGAAAGCAAATTCTGAAGG - Intergenic
971389750 4:26175031-26175053 AATGAGAAAACACATGAAGAGGG - Intronic
971399322 4:26261429-26261451 AAGTAGAAAAGAAATGAGGAAGG + Intronic
971415450 4:26423266-26423288 AAGGAGACATCAAAGGTAGAAGG + Intronic
971628759 4:28961258-28961280 AAAGAGGATTCAAATGAGGAAGG + Intergenic
971867584 4:32192058-32192080 GAGGAAAAATGAAATGATTAAGG - Intergenic
972291109 4:37690751-37690773 AATGAGTAATCAAATGATAGGGG + Intergenic
972353399 4:38258726-38258748 AAGGAGAAATGATATGATCGAGG - Intergenic
972594303 4:40516558-40516580 AAGGAGAAATAGAATGATGAGGG - Intronic
972832313 4:42828541-42828563 AGTGAGAAATAAAATGATGCTGG - Intergenic
973177368 4:47224488-47224510 AAGGAGAAATCACAGGTAGAAGG + Intronic
974890613 4:67877863-67877885 AAGGAGATATCTTTTGATGAAGG - Intronic
975450794 4:74523925-74523947 AAGAAGTAATCAAATAATTATGG - Intergenic
976046131 4:80950261-80950283 AAGGAAACATCAAATGAGAAAGG - Intronic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
977565601 4:98577404-98577426 TGGGAGAAGGCAAATGATGAGGG - Intronic
977851269 4:101832819-101832841 AAGGAGAAAACCAATGGAGATGG - Intronic
978137319 4:105278211-105278233 AAGCAGAATTCACATCATGATGG + Exonic
978451761 4:108841657-108841679 AAGCAGAAATCAAATAATCAAGG + Intronic
978610064 4:110527505-110527527 AAGGAAAGATTAGATGATGATGG + Intronic
978681854 4:111390381-111390403 GAGGAGAAGTCACAGGATGAGGG - Intergenic
978735741 4:112082391-112082413 AAGGAAAAAGCAAATGAAGCAGG + Intergenic
978802412 4:112767989-112768011 AAGGAGAAAACAAAGGGAGAAGG + Intergenic
979405579 4:120306699-120306721 TAGGAGAAATAAAATGTTGGTGG - Intergenic
979621355 4:122801878-122801900 AAGGAGTATTCAAAGGATGTTGG + Intergenic
980194018 4:129564812-129564834 AAGGATAAACCAAATGAAGCTGG - Intergenic
981541262 4:145848846-145848868 AAGGGAAAAGCAAAAGATGAAGG - Intronic
982244530 4:153337734-153337756 AAAGAGAAATCAAACAATAATGG - Exonic
982398354 4:154938004-154938026 CAGAAGAAATGAAAAGATGAAGG + Intergenic
982431061 4:155322626-155322648 AAGGAAAAATCAAATCAGGTAGG - Intergenic
982956569 4:161776460-161776482 AAGGTGAAATCAATTGCTGAAGG + Intronic
983095757 4:163559431-163559453 AAGAAGAAGTCAAAGGATGGAGG + Intronic
983446124 4:167855271-167855293 CAGGAGAAATCTAATGATGGTGG + Intergenic
983499759 4:168485561-168485583 GAGGAGATATCAAATCCTGATGG + Intronic
983644216 4:169973290-169973312 AAGGAGAAATGAAATGGTTTAGG - Intergenic
983767243 4:171499580-171499602 AAGCAGGCATCACATGATGAGGG - Intergenic
984173712 4:176390469-176390491 AGGGAAAAAGAAAATGATGAGGG + Intergenic
984232926 4:177121031-177121053 AAATAGAAAACAAATGATAAAGG + Intergenic
984737941 4:183128575-183128597 AAGTAGAAAGTAAATGATGAAGG - Intronic
985377776 4:189360136-189360158 AAGGAGAAAACCAATGACTAAGG + Intergenic
985993746 5:3584812-3584834 AAGGAGGAATGAAAGGAAGAAGG + Intergenic
986718714 5:10543198-10543220 AAGGAAAAATCAAATATAGACGG + Intergenic
987299670 5:16586173-16586195 AAGAAGAAATAAACTCATGAAGG + Intronic
987856045 5:23422221-23422243 AAGGGGAAAGAAAGTGATGAGGG + Intergenic
987989627 5:25193638-25193660 AAGGGGAAACCAAAAGATAATGG - Intergenic
988176974 5:27741306-27741328 AAGTATAAAACAAATGATGCTGG + Intergenic
988304921 5:29481538-29481560 AAGAAGAAAATAAATAATGAAGG + Intergenic
988305154 5:29485046-29485068 GATGAGAAAACAAATTATGAAGG - Intergenic
988481218 5:31632494-31632516 AAGGAGAAACCAGAGAATGAAGG - Intergenic
989180329 5:38569908-38569930 AAGGGGGAATAAAATGATGAGGG - Intronic
989695638 5:44197215-44197237 AAGGAGATAAGAAATTATGATGG + Intergenic
990977171 5:61570269-61570291 AAGAAGAAAGAAAATGATGGGGG + Intergenic
991074023 5:62514900-62514922 AAGGGGAAGTGCAATGATGAAGG - Intronic
991337447 5:65564666-65564688 AAGGAGAGATCACATCATAAAGG - Intronic
991457002 5:66814567-66814589 AAGGTGAAATGCACTGATGAAGG + Intronic
992188762 5:74269369-74269391 AAGGAGAAATCACTTCAGGAAGG - Intergenic
992434206 5:76739730-76739752 AAATAGATATCAAATGATTATGG - Intergenic
992498064 5:77312550-77312572 AAGAAGCAATGAAATGGTGAAGG + Intronic
992749014 5:79844920-79844942 CAGGAGAAATCAAAAGATCATGG + Intergenic
992829406 5:80579832-80579854 AAGGAGAAAGCATATGCAGAAGG - Intergenic
993238966 5:85354629-85354651 TTGGAGAAATCATAGGATGAAGG + Intergenic
993346923 5:86795719-86795741 AAGGAGAAAACAAAGGAGGAAGG + Intergenic
993807371 5:92428036-92428058 AAGGAGAAACTAAATGAAGAAGG - Intergenic
994763814 5:103890862-103890884 AAGAAGAAAACAAATCCTGATGG - Intergenic
994952619 5:106483769-106483791 AAGGAGAAAGCCAAGGAAGAAGG + Intergenic
995090673 5:108172178-108172200 AATAAGAAATCACATGAAGATGG - Intronic
995182293 5:109240224-109240246 AAGGAAAAATCAAATTGTCAAGG - Intergenic
995350818 5:111173364-111173386 AAGGAGAAATATAAAGATGAAGG + Intergenic
995980675 5:118099295-118099317 AAGGACAAATCTAAGGATGCTGG + Intergenic
996077422 5:119213271-119213293 GAGCAGAAATTAGATGATGATGG - Intronic
996661387 5:126007785-126007807 AGAGAGAGATCAAAGGATGAGGG - Intergenic
996719599 5:126617363-126617385 GAGTAGAAGTCAAATTATGATGG - Intronic
996764852 5:127025760-127025782 AAGAAGAAAGAAAAAGATGAAGG - Intronic
996921362 5:128771266-128771288 AAGCAGAAATTAGATGCTGATGG - Intronic
997007344 5:129833543-129833565 AAGGAACAATCAAAGGCTGATGG - Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997800649 5:136857634-136857656 AAAGAAAAAGGAAATGATGATGG + Intergenic
998303485 5:141050116-141050138 AATGAGAAATCAAATGTTTTAGG + Intergenic
998678654 5:144439230-144439252 TTGGAGAAATACAATGATGAGGG + Intronic
998697664 5:144658562-144658584 AAGCAAAAATAAAATGATAATGG - Intergenic
998840329 5:146246696-146246718 AAAGAGAAAACATATTATGATGG + Intronic
1000718412 5:164676509-164676531 AAAGAGAAATCAAGGAATGAAGG - Intergenic
1000998271 5:167980825-167980847 AAGAGGAAATCAACTGATGATGG + Intronic
1001108411 5:168875326-168875348 AGGGAGAAATGAAAGGAGGAAGG + Intronic
1001162840 5:169336577-169336599 AATCAGAAATCACTTGATGAAGG - Intergenic
1001859716 5:175043263-175043285 AAAGAGAAATTAAAAGAGGAGGG + Intergenic
1002831722 6:827785-827807 AAGGAGAAATAAAATGAAGAAGG - Intergenic
1002840153 6:898519-898541 AGGGAGAAAGCAAAGGATGGAGG - Intergenic
1003065277 6:2899777-2899799 AAGGACAACTCCCATGATGAAGG + Intronic
1004187967 6:13437903-13437925 ACAGAGAAATAAAATGCTGAGGG + Intronic
1004950885 6:20670500-20670522 AAGGAGAAGTCAAAAGCTAATGG - Intronic
1005250759 6:23943282-23943304 AAGGAATAATAAAATAATGATGG + Intergenic
1005442797 6:25889231-25889253 AAGGTGACTTCAAAGGATGATGG - Intergenic
1006119261 6:31794412-31794434 AAAGAGAAATGAAATGAGGAAGG - Intronic
1007015152 6:38458417-38458439 GAGGACAAATCAAATGTGGAAGG - Intronic
1007865259 6:44962112-44962134 AAAGAAAAAGAAAATGATGAGGG + Intronic
1007933730 6:45715113-45715135 AGAGAGGAATGAAATGATGATGG + Intergenic
1008072129 6:47108292-47108314 AAGATGAAAACAAATGATAAAGG + Intergenic
1008176014 6:48269225-48269247 AAGGAGAAATAAAATCTTTACGG - Intergenic
1008206405 6:48664538-48664560 CAGGAGTAAGCAACTGATGATGG + Intergenic
1008973159 6:57393817-57393839 ATGCAAAAATCAACTGATGATGG - Intronic
1008979034 6:57462226-57462248 AAGGAGGTATAAAATGATGAAGG + Intronic
1009162065 6:60295356-60295378 ATGCAAAAATCAACTGATGATGG - Intergenic
1009167168 6:60355220-60355242 AAGGAGGTATAAAAAGATGAAGG + Intergenic
1009272792 6:61636258-61636280 AAATAGAAATCAAATTATGGAGG - Intergenic
1009564431 6:65294014-65294036 AAGGAGAAATCAAATGGAAAGGG + Intronic
1010445512 6:75944481-75944503 AAGCATCAACCAAATGATGATGG - Intronic
1010583151 6:77624075-77624097 ATGGATTAATCAATTGATGAAGG + Intergenic
1011919955 6:92561344-92561366 ATGGAAAAATCAAATCAGGATGG - Intergenic
1012604878 6:101145400-101145422 AAAGAGATAGAAAATGATGATGG + Intergenic
1014096757 6:117469670-117469692 AAGGGGAAATAAAAGCATGAAGG - Intronic
1014301483 6:119687509-119687531 AAGCTTAAATCAAATGAAGAAGG - Intergenic
1014623968 6:123703411-123703433 AAGAAGTGATCAAATCATGAGGG - Intergenic
1014733416 6:125061991-125062013 AATTACAAATCAATTGATGAGGG - Intronic
1014761175 6:125358348-125358370 AAGGAGGGAACAAATGAGGAAGG - Intergenic
1015671186 6:135691860-135691882 ATGTAAAAATCAAATTATGATGG - Intergenic
1016684344 6:146864383-146864405 AAGGTGAAATGAAATGGTGAAGG - Intergenic
1016796615 6:148124804-148124826 AAGAAAAAATCATATGTTGAGGG + Intergenic
1016881769 6:148918528-148918550 AAAGAAAAATCTAAAGATGATGG - Intronic
1016890715 6:149004473-149004495 AAGCAGCAATGACATGATGAAGG + Intronic
1017051008 6:150393317-150393339 AGGGAGAAAAGAAATGATAATGG + Intronic
1017142173 6:151201099-151201121 AACAAGATATCAAATGATGCTGG - Intergenic
1017381231 6:153833085-153833107 ATGGAGAAATCAACAGATGTTGG + Intergenic
1017447530 6:154521024-154521046 AAGGAAAATTTAAATGATGGTGG + Intergenic
1017486639 6:154908300-154908322 AAGGAGATACCTAATGATAATGG - Intronic
1018140538 6:160829662-160829684 AAGGAAAAATCAAATGGAGAGGG + Intergenic
1018812686 6:167308880-167308902 AAGGTGACATCCCATGATGATGG + Intronic
1018960892 6:168447970-168447992 AAGAAGAAATCAAATGTCCATGG - Intronic
1019039933 6:169095385-169095407 CAGGAGAAATCAAAAGACCAAGG + Intergenic
1020446129 7:8269974-8269996 AAGGAGAAAAACAAAGATGAGGG + Intergenic
1020865031 7:13549352-13549374 ATGTAAAAATCAAATGATAATGG + Intergenic
1020993207 7:15228525-15228547 AAGGAGAAAATAAAATATGAAGG + Intronic
1021303129 7:18997000-18997022 AAGAAGAAATCAATTGATAGAGG - Intronic
1021408569 7:20302759-20302781 AAAGAAAAATCAAAAGTTGAAGG + Intergenic
1021427070 7:20512923-20512945 AATGACAAATCAAAAGATTATGG + Intergenic
1021536340 7:21708921-21708943 ATGAAAAAGTCAAATGATGATGG + Intronic
1021885733 7:25136812-25136834 AAGGAGAAAAAAATTGATCAGGG + Intronic
1021916701 7:25440953-25440975 AATCAGAAATGAAATGATAAAGG - Intergenic
1022070310 7:26907134-26907156 AACTAGAACTCAAATAATGAAGG + Intronic
1022409399 7:30126439-30126461 AAGGCTAAATGAACTGATGAGGG + Intronic
1022578819 7:31526977-31526999 AAGGAGTAATCAAAATATGAAGG - Intronic
1022931885 7:35125994-35126016 AAGAAAAATTCAAATAATGAAGG + Intergenic
1023389663 7:39697324-39697346 CAGGAGAAAACAAAGGTTGAGGG - Intronic
1023614265 7:42003503-42003525 ACAGAGAAATAAAATAATGAAGG + Intronic
1025085922 7:56023177-56023199 AAGGAGAACGAAAATGGTGAAGG + Intronic
1026533048 7:71216872-71216894 AAGGAGAAAATAAATGACTAAGG - Intronic
1026624992 7:71984096-71984118 AAGGAGGAAAGAAAAGATGATGG + Intronic
1027160692 7:75800130-75800152 AAGGAGGAATCTAAAGATGGAGG - Intergenic
1027534021 7:79373327-79373349 AAGAAGAAATCAAATGGATAAGG + Intronic
1028091763 7:86711478-86711500 AAGTAAAAAGGAAATGATGAAGG - Intronic
1028095089 7:86750390-86750412 TTGGACAAATCAAATGATGTAGG + Intronic
1028120944 7:87056227-87056249 AAGGAGAAATATAAATATGAGGG - Intronic
1028509437 7:91607612-91607634 AGGGAGAAATCACATTAGGATGG - Intergenic
1028836051 7:95376423-95376445 AAGGAGAAACCAAAAGAACAAGG + Intronic
1029827772 7:103218494-103218516 AAGAAAAATTCAAATAATGAAGG + Intergenic
1030543829 7:110867658-110867680 AAGGTGAAATCTAGAGATGAGGG - Intronic
1032282586 7:130516548-130516570 AAGGAGAGAACAAAAGATGGAGG + Intronic
1033668437 7:143465962-143465984 AAAAAGAAATGAAATGCTGATGG - Intergenic
1033966371 7:146979852-146979874 AAATATAAATCAGATGATGAAGG + Intronic
1034022164 7:147656519-147656541 GAGGAGAAGGCAAAAGATGAGGG + Intronic
1035193079 7:157189694-157189716 AAGGAAAAATCACATGAATATGG - Intronic
1035850151 8:2910934-2910956 AAGGAGAAATGGAAGGATTATGG + Intergenic
1036494559 8:9258481-9258503 AAGGACAAAGAAAATGATGGAGG + Intergenic
1036497019 8:9278821-9278843 AAGGAGATATCAAAGGGTGAAGG - Intergenic
1036615575 8:10385011-10385033 AAGGAAAAATAAAATGATTCAGG + Intronic
1037699066 8:21255897-21255919 AAGGATAAAGCAGATGATCATGG - Intergenic
1038132790 8:24751793-24751815 AAAGATAAATGAAAAGATGAGGG - Intergenic
1039157718 8:34580411-34580433 AAGGAGAACAAAAATAATGATGG - Intergenic
1039174103 8:34783728-34783750 AAAGATAATTCAAATCATGAAGG + Intergenic
1039213619 8:35242949-35242971 AAGGGGAAGTCAAATGATCATGG + Intronic
1039545990 8:38412056-38412078 AAAAGGAAAACAAATGATGAAGG - Exonic
1041296853 8:56365647-56365669 AAGGAGAAAAACAATAATGAAGG + Intergenic
1041641820 8:60210919-60210941 AAGGTGAAAGCAAATAATAAGGG - Intronic
1041766060 8:61419440-61419462 AATGAGAAAGAAAATAATGAGGG + Intronic
1041878748 8:62721764-62721786 AAGGAGTCTTCAAATGATGTAGG - Intronic
1042364441 8:67919986-67920008 AAGGAGAAATAAATAAATGAGGG - Intergenic
1042369666 8:67977227-67977249 AAGGAGAAATCATCAGAAGAGGG + Intronic
1042555233 8:70028792-70028814 CAGGAGAAGTCACAGGATGATGG - Intergenic
1042712699 8:71735708-71735730 AAGCAAAGATCAATTGATGATGG - Intergenic
1042847287 8:73181138-73181160 AAGGAGAAATCATATGGTGGTGG + Intergenic
1043114199 8:76228812-76228834 AAAGAGAAATAAAGTAATGAAGG + Intergenic
1043297264 8:78681864-78681886 AAAGAGAACTCAAATTATGAAGG - Intronic
1043551985 8:81384955-81384977 AAGGAGAAATAAAATACTGAGGG - Intergenic
1043601161 8:81939846-81939868 AAGGAGAGATTAACTGGTGATGG - Intergenic
1044194666 8:89360501-89360523 AAGGACAATTTAAATGATCAAGG - Intergenic
1044705614 8:95005610-95005632 AAGGCACAATAAAATGATGAGGG - Intronic
1046816766 8:118593188-118593210 AATGAGAGATATAATGATGAAGG + Intronic
1047094709 8:121611716-121611738 AACCTAAAATCAAATGATGAGGG - Intergenic
1047350556 8:124069428-124069450 AAGAAGAAACCCAAAGATGATGG + Exonic
1047609030 8:126502606-126502628 AGGGAGATGTCAAAAGATGAAGG + Intergenic
1047652634 8:126939931-126939953 AAGGAGAAATGATTTGATAAAGG + Intergenic
1047710881 8:127551147-127551169 AATTAGAAAACAATTGATGATGG + Intergenic
1047850447 8:128851661-128851683 AAAGAGAAATCAAATGCAGATGG + Intergenic
1048022936 8:130557215-130557237 AAGGAAAGAGCAAAAGATGATGG - Intergenic
1048230998 8:132641548-132641570 AAGGAGAAAAGAAAGAATGAGGG + Intronic
1048524730 8:135191727-135191749 CAGGAAAGATTAAATGATGATGG - Intergenic
1048884078 8:138894565-138894587 AAGGAGAGATCAAAGGCAGATGG + Intronic
1050631436 9:7562787-7562809 GAGGAGACATCAAAGGATGGGGG - Intergenic
1050915516 9:11125644-11125666 AATGGGAAAGCAAAGGATGAAGG + Intergenic
1050950249 9:11582033-11582055 ACAGAGAAGTCAAATAATGATGG - Intergenic
1051159560 9:14191438-14191460 AATGGGAAAATAAATGATGACGG + Intronic
1052403520 9:28030803-28030825 AGGGAGTAATCCAATGATGAAGG + Intronic
1052590406 9:30485703-30485725 AAATAGAAAACAAATGATGGTGG - Intergenic
1054771299 9:69086599-69086621 AAGGGGAAATAAAGGGATGAGGG - Intronic
1055681232 9:78717612-78717634 AAGAAGAAATCAAATGCTGATGG + Intergenic
1055749897 9:79493585-79493607 AAGGACAAAAAAAATGCTGATGG + Intergenic
1055938229 9:81623208-81623230 GAGGAGAAATCACAACATGAGGG - Intronic
1055950346 9:81724409-81724431 AAGGAAGAATCAAAGGAGGAGGG - Intergenic
1056037857 9:82627962-82627984 GAAGAGAAAACAAATAATGAAGG + Intergenic
1057730112 9:97601161-97601183 AAGGAGAAGCCAAATGGGGATGG - Exonic
1058858407 9:109089516-109089538 GAGGAGTAATCAAATGTAGAAGG + Intronic
1058921935 9:109625052-109625074 AAGAAGTACTCAAAGGATGATGG - Intergenic
1059900684 9:118921798-118921820 AGGGAGAAATCAGATGAGGTGGG - Intergenic
1060461528 9:123859708-123859730 AATGGGGAATCTAATGATGATGG - Intronic
1061689645 9:132315814-132315836 AAGGAGAAATCAAATGATGAGGG - Intronic
1186406061 X:9304220-9304242 AAGTAGAAATCAAATTGAGACGG + Intergenic
1186536274 X:10352195-10352217 AAAGGGAAATAAAATTATGAAGG + Intergenic
1186591305 X:10932539-10932561 AAGGGGAAATGAAAGGGTGAAGG + Intergenic
1187673342 X:21690689-21690711 AGTGAGAATTCAAATAATGAAGG + Intergenic
1188089868 X:25951623-25951645 AAACAGAAATCAAATAAAGATGG - Intergenic
1188274696 X:28185293-28185315 ATGAAGAAATGAACTGATGAAGG - Intergenic
1188295414 X:28441299-28441321 AAGAAGAAATCATATGACAAAGG - Intergenic
1188321177 X:28739056-28739078 TTGGAGACATCAAATTATGAAGG - Intronic
1188805695 X:34586284-34586306 CAGGAGATAGGAAATGATGAGGG - Intergenic
1189290125 X:39878862-39878884 GATGTGAAATCAAATGATGCAGG + Intergenic
1189480356 X:41387914-41387936 ATCCAGAAATGAAATGATGAGGG + Intergenic
1190107735 X:47571658-47571680 AAGAGGAAACCAAATGATGGAGG - Exonic
1190871851 X:54431370-54431392 AAAGAGACACCAAATAATGATGG + Intergenic
1191803656 X:65109160-65109182 AAAGTAAAATAAAATGATGAAGG - Intergenic
1192308984 X:69993432-69993454 AAGGATAAATAAAATGACCATGG - Intronic
1193213524 X:78836376-78836398 AAGGAGGAGCCAAATTATGAAGG + Intergenic
1194060393 X:89189501-89189523 AAGAAGTACTCAAATAATGATGG + Intergenic
1194189500 X:90817322-90817344 ATTGAGAAAACAAATGGTGATGG - Intergenic
1194206044 X:91012737-91012759 AAAGAGAAAAGAAATGATAAAGG - Intergenic
1194426677 X:93747449-93747471 AGGGAGAAAAAAGATGATGAAGG + Intergenic
1194665108 X:96668646-96668668 AAGAAGAAATGCAATGTTGAAGG + Intergenic
1195709592 X:107763462-107763484 AAGGACAAATAAACTGATCAAGG - Intronic
1195811571 X:108838254-108838276 AAGAAGAAATAATAAGATGATGG - Intergenic
1196070844 X:111519915-111519937 GAGCAGAAATAAAATGATGTTGG + Intergenic
1197110646 X:122770294-122770316 GAGCAGAAATAAAATAATGAAGG - Intergenic
1197136142 X:123061727-123061749 AAAGAGAAAACAAGTTATGAAGG - Intergenic
1197166088 X:123379212-123379234 AAAGGGAAATAAAATGGTGATGG - Intronic
1197969262 X:132097764-132097786 AAAGAGAATTCAAAGCATGATGG + Intronic
1198179722 X:134194566-134194588 AAGGAGAAAGAAAAAGAAGAAGG - Intergenic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1199265222 X:145820342-145820364 AAGGAGAAAACAGATAATGAAGG + Exonic
1199269456 X:145865545-145865567 AAGAATAATTAAAATGATGAGGG + Intergenic
1199337248 X:146632713-146632735 AAGGAGAAAAGAAATAAAGATGG - Intergenic
1199408247 X:147487767-147487789 CAGAAGAAATTAAAAGATGAAGG - Intergenic
1200165732 X:154033893-154033915 AACCAGAACTCAAATGATGTAGG + Intronic
1200536080 Y:4399212-4399234 ATTGAGAAAACAAATGGTGATGG - Intergenic
1200551804 Y:4587550-4587572 AAAGAGAAAAGAAATGATAAAGG - Intergenic
1200700611 Y:6399135-6399157 AGGATGAAATCAAAAGATGATGG + Intergenic
1200709119 Y:6468102-6468124 AAGATGAAATCACAAGATGATGG + Intergenic
1201024993 Y:9696607-9696629 AAGATGAAATCACAAGATGATGG - Intergenic
1201033501 Y:9765563-9765585 AGGATGAAATCAAAAGATGATGG - Intergenic
1201341638 Y:12940749-12940771 AAGTAGAAAACAAATGAAGTGGG - Intergenic
1202175428 Y:22094621-22094643 AGGATGAAATCAAAAGATGATGG + Intronic
1202215934 Y:22491762-22491784 AGGATGAAATCAAAAGATGATGG - Intronic