ID: 1061689835

View in Genome Browser
Species Human (GRCh38)
Location 9:132318186-132318208
Sequence CAGGAGCTAGTTGGGGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061689835_1061689839 -6 Left 1061689835 9:132318186-132318208 CCTCTATCCCCAACTAGCTCCTG 0: 1
1: 0
2: 0
3: 13
4: 277
Right 1061689839 9:132318203-132318225 CTCCTGTTTGTTGTTCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061689835 Original CRISPR CAGGAGCTAGTTGGGGATAG AGG (reversed) Intronic
900108061 1:993936-993958 CAGGAGCGAGATGGGGTTGGGGG - Intergenic
903909109 1:26709327-26709349 CAGGAGGAAGGTGGGAATAGTGG - Intronic
904742064 1:32685391-32685413 CAGGAGGGAGTTGGGAAGAGAGG + Exonic
904936284 1:34131923-34131945 CATGAGCTAGCTGGGGCCAGGGG + Intronic
905023864 1:34836690-34836712 CAAAAACTAGTTGGGGATGGTGG - Intronic
905172737 1:36118682-36118704 CAGAAGCTGGTTGGGGGTGGGGG - Intronic
908052025 1:60243588-60243610 CACTATCTAGCTGGGGATAGAGG + Intergenic
910789761 1:91038983-91039005 CAACAATTAGTTGGGGATAGTGG + Intergenic
914956490 1:152167339-152167361 CATGAGCTTCTTGGGGACAGTGG - Intergenic
917212292 1:172643462-172643484 CAGGAGATACTTGGGGGGAGAGG + Intergenic
917817897 1:178728930-178728952 AAGTAGCTAGTTAGGGATATGGG + Intronic
918162199 1:181911675-181911697 GAGGAGATAGTTGGGGATGTGGG + Intergenic
919215835 1:194553203-194553225 CAAGGGCTTGTTGGGGATTGAGG - Intergenic
919409438 1:197226051-197226073 CAAAAGTTAGTTGGGCATAGTGG - Intergenic
920851379 1:209630403-209630425 CAGGCTCTAGCTGGGGACAGTGG + Intronic
921784598 1:219214840-219214862 CAAAAACTAGCTGGGGATAGTGG - Intergenic
924298600 1:242614026-242614048 TAGGAGTTAGTAGGGGAAAGGGG + Intergenic
924745924 1:246833654-246833676 GAGGAGGTAGTTGGGAATATGGG - Intergenic
924745931 1:246833704-246833726 AAGGAAGTAGTTGGGGATATGGG - Intergenic
924745939 1:246833754-246833776 GAGGAGGTAGTTGGGGATACGGG - Intergenic
1063233809 10:4091385-4091407 CAGGGACTAGTAGGGGAGAGAGG + Intergenic
1064096034 10:12425155-12425177 CAGGAGCCAGCTGGGGAGAAGGG - Intronic
1064242924 10:13646980-13647002 CATCAGCTAGTTCTGGATAGAGG + Exonic
1066052010 10:31644619-31644641 CAGGAGCTAGTGGGGGTTGGAGG - Intergenic
1066338108 10:34501317-34501339 CAGGAGCAAGTCGGGCAGAGGGG - Intronic
1067063444 10:43089930-43089952 CAGGAGCTTGTTCAGGACAGTGG + Intronic
1068648240 10:59493085-59493107 CAGGCACTGGTTGAGGATAGTGG - Intergenic
1068960599 10:62863078-62863100 CGGCAGCTAGTTGGATATAGAGG - Intronic
1069667796 10:70175326-70175348 CCAGAGCTAGCTGGGCATAGTGG - Intergenic
1069779454 10:70945670-70945692 CAGGAGGTAGTTGGGGCAGGCGG - Intergenic
1071011296 10:80944002-80944024 AAGAAGCAAGTTGGGGATATGGG + Intergenic
1071135240 10:82446060-82446082 TAGGAGGTAGTTGGGGAAAATGG - Intronic
1072542239 10:96406930-96406952 GAGGAGCGAGATGGGGTTAGAGG - Intronic
1075144252 10:119869938-119869960 CAGTAGCTACATGTGGATAGGGG - Intronic
1075772761 10:124954118-124954140 CAGGAATTAGCTGGGGATGGTGG - Intronic
1076343426 10:129765206-129765228 CAGGAGCTACTTAGGGATGAAGG + Intronic
1076750345 10:132539056-132539078 CAGGAGCTTGTTGGAGGAAGGGG - Intronic
1078470258 11:11580750-11580772 CAGGAGTGAGTTAGGGATGGAGG - Intronic
1079048233 11:17128385-17128407 CATTAGCTAGCTGGGCATAGAGG - Intronic
1079275752 11:19035740-19035762 AAGGAGATGGTTGGGGATACAGG - Intergenic
1081142884 11:39524690-39524712 TAGGAGATACTTGGAGATAGAGG - Intergenic
1083385902 11:62310159-62310181 CAGGACCAAGTTGGGGGGAGGGG + Intergenic
1083967030 11:66049262-66049284 CACGAGCAAGTAGGGGAGAGGGG + Intergenic
1084821661 11:71695444-71695466 CAGGTGAGAGTTGGAGATAGGGG - Intergenic
1085223226 11:74894248-74894270 CAGGATCTACTTGAGGGTAGAGG + Intronic
1085515321 11:77108242-77108264 GAGGAGCTCCTTGGGGACAGGGG - Intronic
1086147124 11:83564374-83564396 CACGAGCTAGTCAGGGACAGAGG - Intronic
1086170409 11:83829482-83829504 CAAGAGCTAGCTGGGCACAGTGG - Intronic
1087270662 11:96108245-96108267 CAGGAGTTTGGTGGTGATAGTGG - Intronic
1087846622 11:102980810-102980832 CAGGGCCTGGTTGGGGATGGGGG + Intergenic
1091522289 12:1258006-1258028 CAGTAGCTAGTTGTTGCTAGTGG + Intronic
1092835856 12:12487693-12487715 CAGTAGGTAGTTGGAGATACGGG - Intronic
1094499339 12:31008495-31008517 CAGGAGCTGGTAGTGGAGAGAGG + Intergenic
1095647003 12:44558973-44558995 CTCGAGCTTGGTGGGGATAGGGG + Intronic
1096330269 12:50705748-50705770 CAGTAGCTTGTTGAGGATATGGG + Intronic
1096520210 12:52180739-52180761 AAGGAGCTGGATGGGGATGGGGG + Intronic
1096820098 12:54227185-54227207 CAAAAACTAGTTGGGCATAGTGG + Intergenic
1098008423 12:66023641-66023663 CAGAGGCTAGGTGGAGATAGAGG - Intergenic
1098663463 12:73130079-73130101 GAGGAGTAAGTTGGGCATAGAGG - Intergenic
1098765937 12:74488840-74488862 CAGGGCCTACTTGAGGATAGAGG + Intergenic
1099878442 12:88437271-88437293 CATGAGCTTGGTGGGGGTAGGGG + Intergenic
1101306114 12:103529583-103529605 CAGGAGATAGTCAGGGATGGCGG + Intergenic
1104552619 12:129771104-129771126 CATGAGCTGTTTGGGGAGAGAGG - Intronic
1104555069 12:129792227-129792249 CTGGAGACAGTAGGGGATAGTGG + Intronic
1104922443 12:132298073-132298095 CAGGAGTTAGTTGGTTATTGTGG - Intronic
1105567929 13:21569920-21569942 CAGGAGCTAGTATAGGATCGTGG - Intronic
1105576033 13:21652962-21652984 CAGGAGCTACTTGAGGACAAAGG - Intergenic
1105716617 13:23071903-23071925 CAGGACCTGCTTGAGGATAGAGG - Intergenic
1106923414 13:34588681-34588703 AAGAGGCTGGTTGGGGATAGAGG + Intergenic
1108489344 13:50964935-50964957 TAGGAGCTGGGTGGGGGTAGGGG - Intronic
1110196587 13:72795853-72795875 CAGGGGTTGGTTGGGGATAGTGG + Intronic
1111113722 13:83749520-83749542 CAGGAGTAAGTTGAGCATAGAGG - Intergenic
1112376959 13:98851548-98851570 CAGGTACTGGTTGGGGAGAGTGG + Intronic
1113512634 13:110868150-110868172 GAGGAGCTAGTTGGAGATTCTGG + Intergenic
1113546855 13:111159010-111159032 CAGGAGCTAGACAGGGAAAGGGG - Exonic
1115427072 14:33272567-33272589 CAGAAGCTAGCTGGGCATGGTGG - Intronic
1115698696 14:35926955-35926977 GAGTAGCTAGTTGGGGTTACAGG - Intronic
1118317228 14:64732698-64732720 CTGGAGCTGGGTGGGTATAGAGG + Intronic
1119185710 14:72640919-72640941 AAGGACCTAGTTAGGGGTAGAGG + Intronic
1119867903 14:77989525-77989547 CAGGAGCTATTTGGGGCTAAGGG - Intergenic
1121598132 14:95181510-95181532 CAGGAGTAAGATGGGGACAGAGG - Intergenic
1122163807 14:99805967-99805989 CAGGAGCTGGCGGGGGAGAGTGG - Intronic
1122919698 14:104874947-104874969 CAGGGGCTAGTTGGGGGCAAGGG - Intronic
1123175080 14:106409318-106409340 CAGCAGCTATTTTGAGATAGCGG + Intergenic
1202943605 14_KI270726v1_random:6459-6481 CAGCAGCTATTTTGAGATAGCGG - Intergenic
1123989323 15:25671840-25671862 CAGGAGCTGGAAGGGGAAAGGGG - Intergenic
1125247025 15:37652518-37652540 CAGGAGATAGGAGGGGATAAGGG + Intergenic
1125421772 15:39511408-39511430 CAGGATGAAGTTGGGGAAAGTGG - Intergenic
1126600127 15:50419599-50419621 CAAAAATTAGTTGGGGATAGTGG + Intergenic
1127050254 15:55075652-55075674 AAGGAGATAGTTGGGGGTAATGG + Intergenic
1127215972 15:56823497-56823519 CAGAAGCCACATGGGGATAGTGG + Intronic
1129293252 15:74584687-74584709 CAAGATGTAGCTGGGGATAGGGG - Intronic
1129566828 15:76632478-76632500 CAGGAGCTGGCTGGGTGTAGTGG - Intronic
1131432389 15:92396981-92397003 CCGGAGTGAGTTGGGGATGGAGG - Intronic
1133210068 16:4258562-4258584 CAGAAGTTAGCTGGGGATGGTGG - Intronic
1133801537 16:9090033-9090055 CAGGAGCTATCTGAGGAAAGAGG + Intergenic
1134373684 16:13649730-13649752 CAGGACCTAGTTGAGGGAAGAGG - Intergenic
1135715228 16:24758956-24758978 CAGGAGCTACTTGGTAATAAAGG + Intronic
1136686062 16:31995646-31995668 GAGGATGTAGTTGGGGACAGAGG + Intergenic
1136786675 16:32939175-32939197 GAGGATGTAGTTGGGGATAGAGG + Intergenic
1136883095 16:33914615-33914637 GAGGATGTAGTTGGGGACAGAGG - Intergenic
1138093174 16:54193222-54193244 CATGAGCTCCTTGGGGGTAGGGG + Intergenic
1139339364 16:66257987-66258009 CAGGAGCAAGTAGGGGCTGGTGG - Intergenic
1141235696 16:82213872-82213894 CAGAAGCTAGGTGGTAATAGGGG + Intergenic
1141816792 16:86416061-86416083 CAGCATCTAATTGAGGATAGAGG - Intergenic
1142157365 16:88538703-88538725 CGGGAGCGAGCTGGGGACAGAGG - Intergenic
1203088911 16_KI270728v1_random:1200845-1200867 GAGGATGTAGTTGGGGACAGAGG + Intergenic
1142780158 17:2175319-2175341 CAGGACATAGTTGGGGGTTGGGG + Intronic
1142975004 17:3638027-3638049 CAGGAGCAACCTGGGGCTAGGGG - Intronic
1147147024 17:38491314-38491336 GAGGATGTAGTTGGGGACAGAGG + Intronic
1149580598 17:57747774-57747796 TAAGAGCTAGATGGGGATTGAGG + Intergenic
1152147474 17:78577004-78577026 CAGGAGGAAGCTGGGGCTAGGGG + Intronic
1152308281 17:79533857-79533879 CAGGAGTTATTTCGGGTTAGTGG - Intergenic
1153321047 18:3774586-3774608 AACGGGCTAGTGGGGGATAGTGG + Intronic
1153527844 18:6014700-6014722 GAGGAGCTAGAAGGGAATAGAGG + Intronic
1153783805 18:8516728-8516750 CAGGAGCTTGCTGGGCAGAGGGG - Intergenic
1154007340 18:10543556-10543578 CAGGAAATAGTTGGGGCCAGAGG + Intronic
1154310585 18:13263500-13263522 CAGGAGCTTGCTTGGGAGAGAGG + Intronic
1156538028 18:37882720-37882742 CTGGAGCTAGATGGGGGTACAGG - Intergenic
1157508206 18:48246872-48246894 CAGGACCAAGTCAGGGATAGAGG + Intronic
1157566554 18:48682596-48682618 CAGCAGATAGAAGGGGATAGGGG - Intronic
1158550337 18:58430596-58430618 CAGGAGCCTGGTGGGAATAGGGG + Intergenic
1160109906 18:76016517-76016539 CAGAAGTTAGCTGGGCATAGTGG + Intergenic
1160294205 18:77622677-77622699 CAGGAGCCATTAGGGGTTAGAGG + Intergenic
1160964332 19:1739489-1739511 CAAAAGCTAGTTGGGCATGGTGG + Intergenic
1163030865 19:14543258-14543280 CAGGAGCTGGGTGGGGTTGGAGG + Intronic
1164572401 19:29383914-29383936 CTGGAGCTAGTGGTGGAAAGTGG - Intergenic
1165045936 19:33105068-33105090 CAGGAGCTAGGAGGGGAGTGGGG - Intronic
1166690159 19:44817695-44817717 CAAAAGCTAGCTGGGCATAGTGG - Intronic
926394360 2:12426108-12426130 CAGGAGTAAGATGGGGAGAGAGG - Intergenic
927381964 2:22489596-22489618 CAGGATCTACTTGAGGGTAGAGG + Intergenic
927404693 2:22754060-22754082 CTGGAGCTTGTGGGGGAGAGGGG - Intergenic
927871423 2:26626834-26626856 GAGGAGCCTGTTGGGGTTAGGGG - Intronic
928399777 2:30969408-30969430 CAGGGGCAAGTTGGGGAGGGAGG + Intronic
929234611 2:39592906-39592928 CAGTAGCTACTTGTGGCTAGTGG + Intergenic
929858398 2:45654444-45654466 GAGAAGCTAGTTGGGGACCGAGG + Intronic
930086779 2:47503387-47503409 CAGGAGCTACCTGGGGGTTGAGG + Intronic
931087477 2:58849056-58849078 CAAAAACTAGTTGGGGGTAGTGG + Intergenic
932206172 2:69885026-69885048 AAGGAGGTAGTTGGGGATACAGG - Intergenic
932352479 2:71043652-71043674 CAAGAGCCAGGGGGGGATAGGGG - Intergenic
934909819 2:98241430-98241452 CAGGAGGCAGTTGGGGAGATGGG + Intronic
935828818 2:106978089-106978111 CAGGAGCCAGCTGGTGATAATGG + Intergenic
936497860 2:113038158-113038180 CAGGAGGTAGTTTGGGATCTGGG + Intronic
936499173 2:113052100-113052122 CAAAAACTAGTTGGGCATAGTGG - Intronic
938780546 2:134580933-134580955 CAGGAGCAAGATGTGGATGGTGG + Intronic
938920695 2:135992048-135992070 CAGTAGGAAGTTGGGGAAAGAGG + Intergenic
939483238 2:142776489-142776511 CAGAAGTTAGTTGGGCATGGTGG - Intergenic
939723837 2:145689317-145689339 CAGGACCTATTAGGGGATGGGGG - Intergenic
940078129 2:149767080-149767102 CAGTGGCTGGTTGGGGAAAGAGG - Intergenic
940879425 2:158931790-158931812 ACGGAGCTAGTTGGGGAGACAGG + Intergenic
941226295 2:162853659-162853681 CAGGAAATATTTGGGGATGGTGG + Intergenic
941261142 2:163298972-163298994 CAGGAGCTAGCTGGAGACTGTGG + Intergenic
942249565 2:174036124-174036146 CAGGGGCTAGTTTTGGAAAGTGG + Intergenic
1169318406 20:4611574-4611596 CATGAGCCAGTTGGGAGTAGTGG + Intergenic
1169654607 20:7909039-7909061 CTGGAGCTTGTTTGGGATGGGGG - Intronic
1169972026 20:11278594-11278616 CAGCAGAGAGTAGGGGATAGAGG - Intergenic
1170118822 20:12890783-12890805 CAATAGCTTGTTGGGGATGGTGG + Intergenic
1170286706 20:14717849-14717871 CAAAAGCTAGTTGGAGCTAGGGG + Intronic
1170581666 20:17704028-17704050 CAGAAGCCAGCTGGGGACAGTGG - Intronic
1173067819 20:39729781-39729803 CAGGAGCAAGTGGGGGGTGGGGG - Intergenic
1173966220 20:47114853-47114875 CAGGAGCAAGAGGGGGAGAGTGG - Intronic
1175042896 20:56072483-56072505 CAGGAGCCAGTGTGGGAAAGTGG + Intergenic
1175938245 20:62525141-62525163 CGGGTGCTAGCTGGGGTTAGGGG - Intergenic
1176416657 21:6479306-6479328 CAGGAGATAGGTGCGGAAAGAGG - Intergenic
1178258796 21:31079835-31079857 GAGGAGGTAGTTGGGGACATAGG - Intergenic
1178811411 21:35885748-35885770 CTGGAGCCTGTTGGGGGTAGGGG + Intronic
1178834205 21:36082821-36082843 CAGGATCTTGTTGGAGATTGGGG - Intergenic
1179923409 21:44519916-44519938 CAGGAGGTAGGTGGTGGTAGCGG - Intronic
1180090652 21:45532267-45532289 CAGGGGCGTGTTGGGGAGAGGGG - Intronic
1182762692 22:32735282-32735304 CATCAGCAAGATGGGGATAGTGG + Intronic
1182874946 22:33683665-33683687 CAGAAGATAGATGGAGATAGAGG + Intronic
1184040699 22:41941508-41941530 CAGGTGCTGGTGGGGGACAGTGG - Intronic
1185317269 22:50184611-50184633 GATGAGTTAGTTGGGGAAAGGGG - Intergenic
1185319223 22:50192885-50192907 CAGGAGGCATTTGGGGATATGGG + Intronic
949487891 3:4557769-4557791 CAGAAGCCAGATGGGGGTAGGGG + Intronic
949846097 3:8372203-8372225 CAGGAGCTTGGTGGGGGGAGGGG + Intergenic
950224983 3:11226078-11226100 CAGGGCCTATTTGGGGAGAGTGG + Intronic
950630967 3:14281744-14281766 CAGGAGCAAATTGGGGAGGGCGG - Intergenic
952653215 3:35751261-35751283 CAGCAGATAGTTGGGAGTAGGGG - Intronic
953123964 3:40073453-40073475 CAGGAACTAGGTGGGGACAAAGG - Intronic
953204985 3:40818418-40818440 CAGAAGCAAGGTGGGGACAGAGG - Intergenic
953522861 3:43659486-43659508 CAGGAGCTTGGTGGGGGGAGGGG + Intronic
953749613 3:45599330-45599352 CAGGAGCTGGGAGGGGATGGGGG - Intronic
954163494 3:48738698-48738720 CAGGAGCTAGAGGAGGATGGTGG + Intronic
954807201 3:53227394-53227416 CAGGAGCAAGATGGGGCTGGAGG - Intronic
954963704 3:54591259-54591281 GAGGAGATAGCTGGGGAGAGGGG - Intronic
955589377 3:60518001-60518023 CATGAACTTGTTGGTGATAGTGG + Intronic
956634562 3:71350950-71350972 CAGGAGTGAGTTGGGGGTGGTGG - Intronic
957303936 3:78431677-78431699 CAGGACCTGATTGGGGATTGGGG + Intergenic
957996545 3:87697371-87697393 CTGTAGCTAGTTTGTGATAGAGG + Intergenic
958988070 3:100806366-100806388 CAGGAACTAGTTAAGGATAAGGG + Intronic
961044902 3:123701380-123701402 CAGGAGGAAGGTGGGGATGGGGG + Intronic
962865564 3:139445653-139445675 CAGGAGCTTCTTGAGGACAGGGG + Intergenic
964280114 3:155054662-155054684 CAGAAATTAGTTGGGCATAGTGG + Intronic
965240222 3:166187515-166187537 CAGGAGCTAATTGAGAATGGTGG - Intergenic
966654621 3:182341689-182341711 CAGGACCTACTTGAGGATGGAGG + Intergenic
967162416 3:186750668-186750690 CAGGTGCTGGTTGGGCACAGTGG + Intergenic
967414918 3:189205530-189205552 CGGAAGCTTGCTGGGGATAGGGG + Intronic
968726371 4:2249730-2249752 CAGGAGCTAGAGGGGGATCCAGG + Exonic
969139101 4:5053329-5053351 AAGGAGCCAGTTGTGGACAGAGG + Intronic
972420767 4:38884104-38884126 CAAGAGCTAGTTGGGGTACGGGG + Intronic
973340053 4:48994676-48994698 CAGCAGCCAGTTGGGTCTAGAGG - Exonic
975642529 4:76514477-76514499 CAGGGGCTGGTTTGGTATAGGGG + Intronic
975693951 4:76993228-76993250 AAGGGGCGAGTTTGGGATAGAGG + Intronic
977476917 4:97523008-97523030 CAGGAACTACTTCAGGATAGTGG - Intronic
977499635 4:97822710-97822732 CAGGAGCAAGTAGGGGGTAAGGG + Intronic
980232442 4:130061998-130062020 CAGGAGCTGGTTGAGGTTAGTGG - Intergenic
980803575 4:137784065-137784087 CAGGAGCTTGTTGGGGGGAGGGG + Intergenic
981850988 4:149229808-149229830 CTGGAGCTTGGTGGGGAGAGGGG + Intergenic
982534575 4:156593816-156593838 TAGGAGCTAGTAGGGGAGAGAGG - Intergenic
983597726 4:169489683-169489705 CTGGAGCCAGTAGGGCATAGTGG - Intronic
984717680 4:182940744-182940766 CAGGAGCCAGTGGGGGCTGGAGG + Intergenic
986189035 5:5476610-5476632 CAGGAGCAAGTGAGGGGTAGCGG + Intronic
989358059 5:40567100-40567122 CTGCAGCTAGTTGGGGGGAGGGG - Intergenic
989780016 5:45253722-45253744 GAGGTGCTAGTTGAGGATACTGG + Intergenic
989825344 5:45848100-45848122 CTGGAGCTAGGTGGGGGGAGGGG + Intergenic
990605300 5:57403697-57403719 CAGGAGCTAGCGGGGGACAGAGG - Intergenic
991040157 5:62167053-62167075 CATGATCTAGTTGGGGAGAAGGG - Intergenic
991187765 5:63830457-63830479 CAGGAGTTAGGTGGGTACAGGGG + Intergenic
991187871 5:63831743-63831765 CAGGAGTTAGGTGGGTACAGGGG - Intergenic
995180954 5:109229728-109229750 CAGGAGGCAGTTGGGTATATGGG + Intergenic
995373695 5:111450204-111450226 GAGGAGCTAGCTGGGGATTATGG - Intronic
996252328 5:121351288-121351310 CAGGAGCAAGTGAGTGATAGAGG - Intergenic
996549319 5:124713045-124713067 CAGGTGGTGGGTGGGGATAGAGG - Intronic
997596927 5:135113310-135113332 GAGGAGCTGGTTGGGGTTGGAGG + Intronic
997726728 5:136127080-136127102 CAGGAACAGGTTGGGGAGAGAGG + Intergenic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
999123037 5:149224638-149224660 CAGGATCTAGTTTGGGTAAGGGG - Intronic
999837619 5:155391581-155391603 CAGGAGCTACTTTGTGTTAGAGG - Intergenic
1000672612 5:164080912-164080934 CAGGAGAAAGTGGGGGAGAGGGG + Intergenic
1002064672 5:176646141-176646163 TAGGGGCTAGATGGGGGTAGTGG + Exonic
1004133072 6:12939703-12939725 CAGGAGCTAGGGGGGGCCAGAGG + Intronic
1005887135 6:30105875-30105897 CAGGAGCCAGGTGGGGTAAGGGG + Intronic
1008477522 6:51948423-51948445 GAGGTGGTAGTTGGGGATATTGG - Intronic
1008523102 6:52381230-52381252 CAGGAACTAGGTGGGGGAAGAGG + Intronic
1011515694 6:88150117-88150139 CAGGAGCTACTTGGAGATGGAGG - Intronic
1013109849 6:107056219-107056241 CAAAAACTAGTTGGGCATAGTGG + Intergenic
1014554886 6:122833767-122833789 TAGGAGCAAGTTGGGGGCAGGGG - Intergenic
1015738942 6:136432563-136432585 CAGGAGCTATATGAGGTTAGTGG - Intronic
1023728390 7:43167196-43167218 CAGGAGCTGGAAGAGGATAGGGG - Intronic
1026928500 7:74210127-74210149 CAGGAGCTCCTGGGGGATGGGGG - Intronic
1027404192 7:77842354-77842376 CAAGATCTAGCTGGGCATAGTGG - Intronic
1027500556 7:78944887-78944909 CAGAAATTAGTTGGGCATAGTGG - Intronic
1029147270 7:98455388-98455410 CAGGAGCCTGTTGGGGCTAGAGG + Intergenic
1029937014 7:104436087-104436109 CAGTAGCTTCTTGGGGCTAGGGG - Intronic
1029993024 7:104979362-104979384 CAAGAGGGAGTTGGGGGTAGGGG + Intergenic
1031707707 7:125002036-125002058 CAGAAGCTAGATGTGGGTAGGGG + Intergenic
1032411691 7:131698291-131698313 CAGCAGCTAATTGAGGATGGTGG - Intergenic
1033494586 7:141881223-141881245 CAGCAGCCAGCTGGGGTTAGAGG + Intergenic
1034499060 7:151438497-151438519 CAGCAGCGATTTGGGGACAGGGG + Intronic
1035110940 7:156481209-156481231 CAGGAGCTGGGTGGCCATAGCGG - Intergenic
1037833570 8:22203063-22203085 CAGGAGGTATTAGGGGATACTGG - Intronic
1042899039 8:73703279-73703301 CAGGAGCAATGTGGGGATTGGGG - Intronic
1044118635 8:88366225-88366247 CAGGAGGAAGTTGGGGGTAGAGG + Intergenic
1044695740 8:94920717-94920739 CAGGAGCAAGCTGGGGGTGGAGG - Intronic
1046624097 8:116558870-116558892 AAGGAGCGAGGTGGGGGTAGAGG + Intergenic
1047636364 8:126767591-126767613 CAGGAGGAAGTTGGGGGCAGGGG - Intergenic
1048668717 8:136693433-136693455 CAGGATGTACTTGAGGATAGAGG - Intergenic
1049762573 8:144337836-144337858 CAGGCCCTAATTGGGGACAGAGG - Intergenic
1051571483 9:18563853-18563875 CTGGAGCTTGGTGGGGGTAGGGG - Intronic
1053032098 9:34789103-34789125 TGGGAGCTAGGTGGGGATAAAGG + Intergenic
1053076564 9:35139110-35139132 CAGGAGCCAGGAGGGGAGAGAGG - Intergenic
1053437083 9:38083020-38083042 CAGGAGCTAGCTTGGCATGGAGG + Intergenic
1057473801 9:95381673-95381695 GTGGAGCTACTTGGGGAAAGAGG - Intergenic
1057725252 9:97563896-97563918 CAGGGGCTGGGTGGGGGTAGGGG - Intronic
1059993521 9:119887794-119887816 CCAGAGCTATTTGGGGAGAGGGG - Intergenic
1060310234 9:122453067-122453089 CAGGAGCAAGGCGGGGATACGGG - Intergenic
1060348394 9:122836755-122836777 CAGAAGCAAGGTGGGGGTAGGGG + Intergenic
1060645514 9:125275594-125275616 CAAGAGTTAGTTGGGCATGGTGG + Intronic
1061689835 9:132318186-132318208 CAGGAGCTAGTTGGGGATAGAGG - Intronic
1062225074 9:135445617-135445639 CAGGAGCTGGAAGGGGATCGTGG + Intergenic
1185950694 X:4429907-4429929 CAAAAGTTAGTTGGGGATGGTGG - Intergenic
1186654824 X:11601194-11601216 TAGGAGCTAGTGGGGCTTAGGGG + Intronic
1186699088 X:12070022-12070044 CAGGAGCTAGTGGGGAATGTGGG + Intergenic
1188754641 X:33947414-33947436 CAGGGCCTACTTGAGGATAGAGG - Intergenic
1189619076 X:42816508-42816530 CTGGAGCTTGGTGGGGAGAGGGG - Intergenic
1191969675 X:66799330-66799352 CTGGAGCTTGGTGGGGGTAGGGG + Intergenic
1192274921 X:69618635-69618657 CAGGAGGTAGTTGGGGGAATGGG - Intronic
1192635422 X:72811699-72811721 CAGGAGCTGTTGGGGGGTAGGGG - Intronic
1192646292 X:72909104-72909126 CAGGAGCTGTTGGGGGGTAGGGG + Intronic
1192845941 X:74907245-74907267 CAGGAGGTAGTTTGGGAAGGTGG + Intronic
1193159206 X:78208800-78208822 CTGGAGCTGGTTGGGGGTGGGGG + Intergenic
1193218401 X:78892988-78893010 CAGGAGCTACTTTGGGGTGGGGG - Intergenic
1195641421 X:107179405-107179427 AAGGAGAGAGTTGGGGGTAGGGG - Intronic
1195703744 X:107723830-107723852 GAGGATCTTGTTGGGGATGGGGG + Intronic
1195712935 X:107789421-107789443 CAAATGCCAGTTGGGGATAGAGG - Intronic
1196015141 X:110931311-110931333 CAGGGCCTACTTGGGGATGGAGG + Intergenic
1198463306 X:136883237-136883259 GAGGAGCAAGTTTGGGATATAGG + Intergenic
1199257746 X:145735977-145735999 CAGGACCTACTTGAGGACAGAGG + Intergenic
1200052603 X:153442966-153442988 CAGGACCTAGTTTGGGAATGTGG - Intergenic
1201332843 Y:12845977-12845999 CAGAAACTAGCTGGGAATAGTGG - Intronic