ID: 1061693632

View in Genome Browser
Species Human (GRCh38)
Location 9:132355068-132355090
Sequence CAGAAAGCAGCGGCCGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 1, 2: 3, 3: 35, 4: 426}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061693632_1061693640 -5 Left 1061693632 9:132355068-132355090 CCCGCCCCGGCCGCTGCTTTCTG 0: 1
1: 1
2: 3
3: 35
4: 426
Right 1061693640 9:132355086-132355108 TTCTGGTTTTGGTGCCCCCCAGG 0: 1
1: 1
2: 0
3: 9
4: 109
1061693632_1061693646 3 Left 1061693632 9:132355068-132355090 CCCGCCCCGGCCGCTGCTTTCTG 0: 1
1: 1
2: 3
3: 35
4: 426
Right 1061693646 9:132355094-132355116 TTGGTGCCCCCCAGGGGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 159
1061693632_1061693644 1 Left 1061693632 9:132355068-132355090 CCCGCCCCGGCCGCTGCTTTCTG 0: 1
1: 1
2: 3
3: 35
4: 426
Right 1061693644 9:132355092-132355114 TTTTGGTGCCCCCCAGGGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 106
1061693632_1061693647 8 Left 1061693632 9:132355068-132355090 CCCGCCCCGGCCGCTGCTTTCTG 0: 1
1: 1
2: 3
3: 35
4: 426
Right 1061693647 9:132355099-132355121 GCCCCCCAGGGGGCGGGGCATGG 0: 1
1: 0
2: 4
3: 38
4: 536
1061693632_1061693654 17 Left 1061693632 9:132355068-132355090 CCCGCCCCGGCCGCTGCTTTCTG 0: 1
1: 1
2: 3
3: 35
4: 426
Right 1061693654 9:132355108-132355130 GGGGCGGGGCATGGGAAGAGCGG 0: 1
1: 1
2: 16
3: 108
4: 1212
1061693632_1061693642 -3 Left 1061693632 9:132355068-132355090 CCCGCCCCGGCCGCTGCTTTCTG 0: 1
1: 1
2: 3
3: 35
4: 426
Right 1061693642 9:132355088-132355110 CTGGTTTTGGTGCCCCCCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 141
1061693632_1061693649 9 Left 1061693632 9:132355068-132355090 CCCGCCCCGGCCGCTGCTTTCTG 0: 1
1: 1
2: 3
3: 35
4: 426
Right 1061693649 9:132355100-132355122 CCCCCCAGGGGGCGGGGCATGGG 0: 1
1: 0
2: 3
3: 29
4: 274
1061693632_1061693645 2 Left 1061693632 9:132355068-132355090 CCCGCCCCGGCCGCTGCTTTCTG 0: 1
1: 1
2: 3
3: 35
4: 426
Right 1061693645 9:132355093-132355115 TTTGGTGCCCCCCAGGGGGCGGG 0: 1
1: 0
2: 1
3: 4
4: 150
1061693632_1061693643 -2 Left 1061693632 9:132355068-132355090 CCCGCCCCGGCCGCTGCTTTCTG 0: 1
1: 1
2: 3
3: 35
4: 426
Right 1061693643 9:132355089-132355111 TGGTTTTGGTGCCCCCCAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 128
1061693632_1061693641 -4 Left 1061693632 9:132355068-132355090 CCCGCCCCGGCCGCTGCTTTCTG 0: 1
1: 1
2: 3
3: 35
4: 426
Right 1061693641 9:132355087-132355109 TCTGGTTTTGGTGCCCCCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 111
1061693632_1061693655 23 Left 1061693632 9:132355068-132355090 CCCGCCCCGGCCGCTGCTTTCTG 0: 1
1: 1
2: 3
3: 35
4: 426
Right 1061693655 9:132355114-132355136 GGGCATGGGAAGAGCGGCCGCGG 0: 1
1: 0
2: 1
3: 20
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061693632 Original CRISPR CAGAAAGCAGCGGCCGGGGC GGG (reversed) Intergenic
900212623 1:1463615-1463637 AAGAAAGCAGAGGCCGGGCATGG + Intronic
900225302 1:1530242-1530264 AAGAAAGCAGAGGCCGGGTATGG + Intronic
902203175 1:14848969-14848991 CAGGAAGCAGGGACCAGGGCAGG + Intronic
902573990 1:17365575-17365597 CAGAAAGTAGAGGCTGGGCCAGG + Intergenic
902664881 1:17930489-17930511 CAGGAAGCAGCGGCCAGGAGAGG - Intergenic
902827900 1:18989617-18989639 CAGCAAGCAGCCTCCTGGGCTGG - Intergenic
903355013 1:22741124-22741146 CAGAGAACAGGGGTCGGGGCAGG - Intronic
903420253 1:23213852-23213874 CAGAAAGCAGAGAGAGGGGCTGG - Intergenic
903436964 1:23357277-23357299 CAGAAAGCAGCTGCAGGGGCTGG + Intergenic
903704157 1:25272728-25272750 CAAATAGCAGGGGCAGGGGCGGG + Intronic
903723081 1:25420584-25420606 CAAATAGCAGGGGCAGGGGCGGG - Intronic
904237511 1:29124430-29124452 GCGAAAGCAGCGCCCGGGGAGGG + Intergenic
904277928 1:29396284-29396306 CAGAAAGGAGAGGCGGGGGTTGG - Intergenic
904619080 1:31764550-31764572 CAAGAAGCAGCGGGCTGGGCGGG - Intronic
904720091 1:32500934-32500956 GAGACAGCAGCCGCCGGGGGCGG + Intronic
905771631 1:40641813-40641835 CAGCAAGCCGGGGGCGGGGCTGG - Exonic
906635263 1:47405514-47405536 CAGAAAGCAACAGCCTGGGTGGG + Intergenic
907910909 1:58825201-58825223 CAGAAAGCAGCAGGTGGGGCGGG - Intergenic
910369088 1:86497022-86497044 CAAAAAGCAGTGGCATGGGCTGG - Intronic
910387983 1:86705125-86705147 CAGAAATCCGCCGCCGGGCCCGG - Intronic
912409801 1:109472908-109472930 AAGAAAGCAGGGGCCGGGCATGG - Intronic
912519247 1:110234048-110234070 CAGAAAGGAGAGGCAGAGGCAGG - Intronic
913556634 1:119973794-119973816 AAGAAAGCACCAGCCTGGGCTGG + Intronic
913939228 1:125086684-125086706 CAAAAAGCCGCGGCGGCGGCAGG + Intergenic
913979587 1:143497473-143497495 CAAAAAGCCGCGGCGGGGGGTGG - Intergenic
914073902 1:144322830-144322852 CAAAAAGCCGCGGCGGGGGGCGG - Intergenic
914105251 1:144643530-144643552 CAAAAAGCCGCGGCGGGGGGCGG + Intergenic
914803029 1:150974384-150974406 CTCAAGGGAGCGGCCGGGGCCGG - Intronic
916069171 1:161159961-161159983 CAGAAAGCAGTAGTCGGGGATGG - Intronic
919427477 1:197450648-197450670 CAGAAAGCATAGGCCGGGCGCGG + Intronic
919802985 1:201364667-201364689 CACAGAGCAGCTGCCAGGGCAGG - Intronic
919828410 1:201520464-201520486 AAGAAAGCCGAGGCTGGGGCCGG + Intergenic
920166701 1:204041342-204041364 CAGAAAGCTGGGGGTGGGGCAGG - Intergenic
921189964 1:212700057-212700079 CGGAAAGCCGCGGCAGGGGTGGG - Intergenic
922005870 1:221530096-221530118 CTCAAAGCAGCGGGTGGGGCTGG - Intergenic
922570113 1:226629586-226629608 CAGAGAGGACCGGCAGGGGCTGG + Intergenic
923254984 1:232214081-232214103 AAGAAAGCAGAGGCAGGAGCTGG + Intergenic
924414929 1:243849685-243849707 CAGACAGCAGGCGCCGGGCCGGG + Intronic
924912234 1:248526391-248526413 CAGTAATCAGCAGCTGGGGCTGG + Intergenic
1063644452 10:7865175-7865197 CAGAAAGTAGGGGCCGGGCATGG + Intronic
1064002253 10:11673369-11673391 CAGAAAGCAGCCGAGGGAGCTGG - Intergenic
1064162825 10:12960474-12960496 CAGAAAGCAGCTGCCAGGCAGGG + Intronic
1064322712 10:14320566-14320588 AAGAAATCAGAGGCAGGGGCAGG - Intronic
1065149799 10:22811156-22811178 GAGAAAGCAGGGGCCCAGGCTGG - Intergenic
1065414465 10:25469493-25469515 CAGCAAGAATCGGCCGGGCCTGG + Intronic
1066745130 10:38600677-38600699 CAAAAAGCCGCGGCCGGGAGGGG - Intergenic
1066950517 10:42112160-42112182 CAAAAAGCCGCGGCAGCGGCTGG + Intergenic
1067284751 10:44899339-44899361 TAGAAAGCAGCAGCCCAGGCCGG - Intergenic
1067577647 10:47418418-47418440 CACAAAGCAGCAGCAGGGTCAGG - Intergenic
1069717393 10:70529881-70529903 CAGGAAGTAGCGGCCCTGGCAGG - Exonic
1069837496 10:71318672-71318694 AAGAAAGCAGGGGCCGGGCGCGG - Intergenic
1069852803 10:71421265-71421287 CAGAAGGCAGAGGGCTGGGCAGG - Intronic
1070667854 10:78358186-78358208 CAGAAAGCTGCAGACGGGACTGG + Intergenic
1070786240 10:79163765-79163787 CAGAGAGCAGCGGACTTGGCGGG - Intronic
1071014447 10:80978289-80978311 GAGAAAGCACCGGCCGGGCGCGG - Intergenic
1072475504 10:95756177-95756199 CAGCAAGCAGAGGCTGGGGGGGG + Intronic
1072838590 10:98744229-98744251 TAGAAAGCAGCAGACAGGGCTGG + Intronic
1073381130 10:103078861-103078883 CAGACAGCAGCGGGCCGGGCTGG + Exonic
1074530358 10:114293227-114293249 CAGAAGACAACGTCCGGGGCAGG + Intergenic
1075068960 10:119308284-119308306 CAGGAAGCTGAGGCCGGGGCAGG - Intronic
1075629372 10:123991859-123991881 CAGAAAGCAGGCGGCGGGGCGGG + Intergenic
1075999909 10:126905897-126905919 CAGATAGCAGCGGCCGGGGCCGG - Intronic
1076076372 10:127537123-127537145 CAGATAGCAGGTGACGGGGCAGG - Intergenic
1076657904 10:132036737-132036759 CGGTGAGCAGCGGCCGGGGTGGG + Intergenic
1076812928 10:132898572-132898594 CAGCAAGCAGAGGGCAGGGCAGG - Intronic
1077026624 11:442563-442585 CAGAAAGCAGGGGCTTGGGTAGG - Intergenic
1077027631 11:448308-448330 CAGGGTGCAGAGGCCGGGGCGGG - Intronic
1077121495 11:910930-910952 CCGAAAGTCGGGGCCGGGGCCGG + Intronic
1077314682 11:1913434-1913456 CAGAAAGCGGGGGCCGGGCGCGG - Intergenic
1077327521 11:1970106-1970128 CAGAAAGCAGACGCCAGGCCGGG - Intronic
1077514214 11:2992072-2992094 CAGGCAGCGGCGGCCGCGGCGGG - Intronic
1078003231 11:7513946-7513968 CCGACCGCAGCGGCCGGGGCCGG - Exonic
1081207607 11:40293382-40293404 CAGAACTCCGCGGTCGGGGCCGG + Exonic
1081773832 11:45664989-45665011 CAGGAAGGGGCTGCCGGGGCTGG - Intronic
1081805042 11:45885831-45885853 GAGAAAGCGGCGGCCTGGGAGGG + Exonic
1081878605 11:46428717-46428739 AAGAAAGCCGAGGCTGGGGCTGG - Intronic
1082774922 11:57237452-57237474 CAGAAAGGAGAGGCGGGGCCAGG - Intergenic
1083365487 11:62139370-62139392 CAGAAAGGAGCTGGCGGGGGAGG - Intronic
1083641152 11:64146104-64146126 CAGATAGCAGAGTCCTGGGCAGG - Intronic
1084419502 11:69053267-69053289 CAGAAGGCACCGGCAGAGGCTGG + Intronic
1085191056 11:74623141-74623163 CAGAAAGTAGGGGCCGGGTGTGG + Intronic
1085341270 11:75733079-75733101 CAGAGAGCAGCGAAGGGGGCGGG - Intergenic
1085643132 11:78205868-78205890 CATCAAGCAGCTGCTGGGGCAGG + Exonic
1086438019 11:86800616-86800638 CAGCGAGCCGCGGCCCGGGCGGG + Exonic
1086850262 11:91799890-91799912 CAAAAAGCAGCAGCAGGGCCAGG + Intergenic
1089623873 11:119739209-119739231 CAGAAAGCAGCAGCCAGGGCAGG + Intergenic
1089740480 11:120578766-120578788 CAGAAACCAGGGGCCGGGCGGGG - Intronic
1090654762 11:128834587-128834609 AAGAAAGCAGAGCCCAGGGCAGG - Intergenic
1090692599 11:129199643-129199665 CAGAAATCTGCTGCAGGGGCGGG + Intronic
1090974978 11:131672760-131672782 CAGAAAGAAGAGGCCAAGGCTGG - Intronic
1090987972 11:131789664-131789686 AAGAAAGCATGGGCCGGGGGCGG + Intronic
1091319026 11:134636623-134636645 CAGGAAGCAGAGGCCAGTGCAGG + Intergenic
1202810503 11_KI270721v1_random:25286-25308 CAGAAAGCAGACGCCAGGCCGGG - Intergenic
1091749724 12:3014790-3014812 CAGGAAACCGCGGCCTGGGCAGG - Intronic
1091791964 12:3277071-3277093 CAGCAAGCAGTGCCCGGAGCTGG + Intronic
1092180730 12:6445069-6445091 CAGAAAGGAGCCGCCTGGGCAGG + Exonic
1092242794 12:6845810-6845832 GAGGAAGCAGCAGCCAGGGCTGG - Intronic
1092595394 12:9998446-9998468 GAGAAGGCAGGGGCAGGGGCAGG - Intronic
1092599067 12:10039033-10039055 GAGAAGGCAGGGGCAGGGGCAGG + Intronic
1094107971 12:26833305-26833327 CAGGGAGCAGCGGCCGGGGGCGG + Intergenic
1094491095 12:30961183-30961205 CAGAAAGCAGCAGAAGAGGCAGG - Intronic
1096191876 12:49624551-49624573 CAGAAAGAAGCAACAGGGGCCGG + Intronic
1096460768 12:51820585-51820607 CAGCAGGCGGCGGCCGGGGCGGG - Intergenic
1098450118 12:70610086-70610108 CGGAAGTCAGCGGACGGGGCTGG - Intronic
1101508493 12:105370884-105370906 CAAAATGCAGCGGCCCTGGCTGG - Exonic
1101865118 12:108515066-108515088 CAATAAGCAGCGGGAGGGGCGGG - Intergenic
1103361464 12:120356868-120356890 CAGAAAGAAGCCGCAGGCGCAGG + Intronic
1103861222 12:124015927-124015949 CAGTCAGCAGGGGCCAGGGCAGG - Intronic
1103965388 12:124635871-124635893 CAGAAAGCAGCAGGTGGGGGTGG - Intergenic
1104614912 12:130259478-130259500 CAGTAAGCAGCAGCAGGGGAAGG - Intergenic
1104632428 12:130414567-130414589 CAGAGAGCACAGGCTGGGGCAGG + Intronic
1105253085 13:18718507-18718529 CAGAATGCAGTGGCAGGAGCTGG + Intergenic
1112498244 13:99922512-99922534 CACAAAGCAGTGGCTGGGGAGGG - Intergenic
1113882572 13:113635827-113635849 CAGCACCCAGCGGCCGGCGCTGG + Intronic
1113884549 13:113651815-113651837 CAGAAAGCCCAGGCTGGGGCCGG - Intronic
1115310485 14:31974111-31974133 CAGGAAGCAGTGGCAGGGCCAGG - Intergenic
1115804642 14:37037091-37037113 AATAAAGCAGAGGCTGGGGCGGG + Intronic
1118534106 14:66739504-66739526 AAAAAAGCAGGGGCCGGGGGTGG - Intronic
1119393931 14:74311698-74311720 AAGAAAGCTGCGGCCGGGAGCGG - Intronic
1119896262 14:78222270-78222292 CAGAGAGCAGCTGCTGGAGCAGG + Intergenic
1122190679 14:100040495-100040517 CAGAAAGCAGCCATCTGGGCAGG + Intronic
1122428445 14:101624895-101624917 CACACTGCAGAGGCCGGGGCAGG + Intergenic
1122666623 14:103334467-103334489 CAGCGAGGAGCGGCCGGGCCAGG - Exonic
1122898839 14:104773758-104773780 CAGCAGGCAGCTGCCTGGGCAGG + Intronic
1123108281 14:105853008-105853030 CAGACAGCAGCAGCCCGGGAAGG - Intergenic
1123396561 15:19943739-19943761 CAGAAAGCCGCGGCGGCGACGGG - Intergenic
1123396578 15:19943778-19943800 CAAAAAGCCGCGGCCGCGGGGGG - Intergenic
1123396659 15:19944056-19944078 CAGAAAGCCGCGGCGGGGTGGGG - Intergenic
1124640478 15:31393254-31393276 CAGTAAGCAGCCGCCGGGCCCGG + Intronic
1125501410 15:40242110-40242132 CAGAGAGTAGGGGCCAGGGCAGG + Intronic
1125518034 15:40333837-40333859 CAGAGAGCAGCAGCCATGGCAGG + Exonic
1125544011 15:40489335-40489357 GAGAAAGGAGGGGGCGGGGCGGG + Intergenic
1125576577 15:40759831-40759853 CAGAGAGCAGCTGCCCAGGCTGG + Intergenic
1128075581 15:64823533-64823555 GAGAAAGCAGAGGCCGGGCATGG - Intronic
1128879999 15:71234257-71234279 CAGAATGCAGTGGCCTGGGCTGG - Intronic
1129679552 15:77650532-77650554 CAGAACCCAGAGGCCAGGGCTGG + Intronic
1129787127 15:78316855-78316877 CAGGAATCAGCAGCGGGGGCAGG + Intergenic
1129975346 15:79816869-79816891 CAGAAAGCAGCAGGCGGGGGTGG + Intergenic
1130232655 15:82108684-82108706 CAGAGAGCTGGGGCTGGGGCTGG + Intergenic
1131114053 15:89783526-89783548 CAGTACCCAGCGGCCGTGGCTGG - Intergenic
1131514220 15:93066531-93066553 CAGAAAGCAGGTGGCGGGGAGGG - Intronic
1132463912 16:68878-68900 CAGAAAGCAGGAGCCGATGCAGG + Intronic
1132761531 16:1510789-1510811 GAGAACGCAGCGGCCCGGGCCGG - Exonic
1132853738 16:2035777-2035799 CAGCAAGCAGGGGCTGGGGCAGG - Intronic
1132903877 16:2272331-2272353 CAGACAGCAGCTGCCCTGGCTGG + Intergenic
1133026218 16:2990013-2990035 CAAAGAGCTGGGGCCGGGGCAGG - Intergenic
1133305046 16:4803129-4803151 GAGAAGGCAGCGGCGGGGCCGGG - Intergenic
1135237066 16:20767219-20767241 CAAAAAACAGGGACCGGGGCCGG + Intronic
1136135379 16:28253853-28253875 CAGAATGTTGCGGCCGGGGAAGG - Intergenic
1136279504 16:29199696-29199718 CAGAAAGGAGGCGGCGGGGCCGG - Intergenic
1136698957 16:32115589-32115611 CAAAAAGCAGCGGCGGCGGGTGG - Intergenic
1136768532 16:32811825-32811847 CAAAAAGCCGCGGCCGCGGCGGG + Intergenic
1136858541 16:33680742-33680764 CTGAAAGGAGCGGGCAGGGCTGG - Intergenic
1136957289 16:34802414-34802436 CAAAAAGCAGCGGCGGCGGGGGG - Intergenic
1136957371 16:34802693-34802715 CAAAAAGCCGCGGCGGCGGCGGG - Intergenic
1138153118 16:54677803-54677825 TAGAAAGCAGGGGCCGGGCGTGG + Intergenic
1138516086 16:57536221-57536243 CGGAATGCCGCGGCCCGGGCCGG - Intronic
1139364781 16:66426905-66426927 CACACAGCAGCAGGCGGGGCAGG - Intergenic
1139664939 16:68448632-68448654 CAGGAACCTGCGGGCGGGGCCGG - Exonic
1139868005 16:70079193-70079215 GAGAAAGCCGAGGCCGGGGTTGG - Intergenic
1139921665 16:70464359-70464381 CAGACAGCAGAGGCCGGGCGCGG + Intronic
1140440849 16:74986281-74986303 CAGAAAACAGCGGCCGGGCGCGG - Intronic
1142014831 16:87739814-87739836 CAGACAGCAGGGACCGGGGACGG + Intronic
1142071418 16:88092867-88092889 CAGAAGGCACAGGCTGGGGCAGG - Intronic
1142216730 16:88833744-88833766 AAGAAAGCAGGGGAGGGGGCTGG - Intronic
1142247472 16:88976599-88976621 CAGAGAGCGGCAGCCGGTGCCGG - Intronic
1142362386 16:89633545-89633567 CAGAAAGCAGAGCCCGCAGCTGG + Intronic
1203070940 16_KI270728v1_random:1073893-1073915 CAAAAAGCCGCGGCCGCGGCGGG + Intergenic
1142560163 17:804972-804994 CAGAGAGAAGCGGCAGGGACAGG + Intronic
1142764382 17:2057300-2057322 CAGAGTGCGGCGGCCGGGCCGGG - Exonic
1142989988 17:3724001-3724023 GAGACAGCGGCGGCCGGGCCGGG + Exonic
1143235329 17:5394645-5394667 CAGCAAGCTGGGGCTGGGGCTGG + Intronic
1143882030 17:10036997-10037019 CACACAGCTGGGGCCGGGGCCGG - Intronic
1144045059 17:11447900-11447922 CAGACAGCAGTGGGCAGGGCTGG + Intronic
1145272543 17:21412558-21412580 CAGAAAGAGGCAGCCAGGGCCGG - Intronic
1145690065 17:26731201-26731223 CAAAAAGCTGCGGCGGCGGCGGG - Intergenic
1145693104 17:26765832-26765854 CAAAAAGCCGCGGCCGCGGAGGG - Intergenic
1145693208 17:26766179-26766201 CAAAAAGCCGCGGCGGTGGCGGG - Intergenic
1145994257 17:29096539-29096561 CTGAAAGCAGAGGCCTGGGCAGG + Intronic
1146218998 17:31002208-31002230 AAGGAAGCAGAGGCCGGGACAGG + Intergenic
1146946479 17:36877156-36877178 CAGAAGCCAGAGGCCTGGGCCGG + Intergenic
1147437492 17:40426139-40426161 CTGACAGCAGAGGCCAGGGCTGG + Intergenic
1148111595 17:45147546-45147568 CGGAAAGCCGGGGCCGGGGGCGG - Intergenic
1150112707 17:62516385-62516407 AAGAAAGCCGAGGCTGGGGCTGG - Intronic
1150790601 17:68198173-68198195 CGGAGAGCAGGGGGCGGGGCGGG + Intergenic
1150833120 17:68541203-68541225 CAGAGGGGAGAGGCCGGGGCAGG + Intronic
1151374670 17:73679063-73679085 CAGACAGGAGGGGCAGGGGCCGG - Intergenic
1151824334 17:76515315-76515337 CAGAAAGCAGAGTCCTGGCCTGG - Intergenic
1152472787 17:80499732-80499754 CAGAAAGCAGTGCCCGAAGCTGG + Intergenic
1152791819 17:82284167-82284189 CAGAAAGCAGGGGCCGGGCGCGG + Intergenic
1152910336 17:83001586-83001608 CAGAAAGCAGAGGGGCGGGCGGG + Intronic
1203192333 17_KI270729v1_random:200552-200574 CAAAAAGCGGCGGCGGCGGCGGG - Intergenic
1154014575 18:10604967-10604989 GAGAAAGCAGAGGACGGAGCAGG - Intergenic
1154190912 18:12230610-12230632 GAGAAAGCAGAGGACGGAGCAGG + Intergenic
1154268150 18:12896855-12896877 CAGAAAGCCCGGGCCAGGGCGGG + Intronic
1154953797 18:21235388-21235410 AAGAAAGCATGGGCCGGGCCTGG - Intergenic
1156397209 18:36709133-36709155 CCGGAAGCAGAGGCAGGGGCGGG + Exonic
1157384188 18:47247928-47247950 CTGAAGGCGGCGGCCGCGGCAGG + Intronic
1157778969 18:50420663-50420685 CAGAAAACACCGGCAGGGGTGGG + Intergenic
1158454478 18:57594059-57594081 CAGAAAGCAGGGGTCAGGCCAGG + Intergenic
1158658145 18:59359365-59359387 CGGAAAGCGGAGGCCGGGGGCGG - Exonic
1160140011 18:76312922-76312944 CACAATGCAGGGGCGGGGGCAGG + Intergenic
1160500980 18:79400908-79400930 CAGAAGGCGGCGGCAGGGGCGGG - Intronic
1160794996 19:941119-941141 TAGAAAGCATGGGGCGGGGCCGG - Intronic
1161052037 19:2169182-2169204 CAGTGAGTAGCAGCCGGGGCGGG + Intronic
1161126740 19:2562092-2562114 AAGAAACCAGGGTCCGGGGCAGG + Intronic
1161504447 19:4636348-4636370 CCGGAACCCGCGGCCGGGGCGGG - Intergenic
1161583182 19:5091737-5091759 CAGAAGGCAGGGGCTGGGGAAGG + Intronic
1161873238 19:6886802-6886824 CAGAAAGCACCAGCTGGGGGAGG - Intergenic
1162111907 19:8403986-8404008 CAGGCAGCGGGGGCCGGGGCAGG + Exonic
1162188082 19:8922718-8922740 CTGAAATCAGTGGGCGGGGCAGG + Intronic
1162345404 19:10115443-10115465 CAGGGAGCAGGGGCTGGGGCAGG + Intronic
1163035141 19:14565519-14565541 CAGAAAGCAGGGGCGGCGGGAGG + Intronic
1163120378 19:15213831-15213853 CAGCCAGCAGGGGCCGGGGAGGG - Intergenic
1163573904 19:18099327-18099349 CGGAAAGGAGGGGGCGGGGCGGG + Intronic
1163741467 19:19016297-19016319 CAGAAATAAGCGGCCGGGCATGG - Intronic
1163821462 19:19498797-19498819 CACACAGCAGAGGCTGGGGCAGG + Intronic
1165248848 19:34513941-34513963 CAGAGAGCAGGGCCCTGGGCAGG + Intergenic
1165266184 19:34665069-34665091 CAGAGAGCAGGGCCCAGGGCAGG - Intronic
1166103560 19:40586153-40586175 CAGAGAACAGAGGCCGAGGCAGG - Intronic
1166368287 19:42288054-42288076 CAGAGAGGAGCTGCTGGGGCAGG - Intronic
1167052274 19:47086519-47086541 CAGGCAGCCGAGGCCGGGGCCGG - Exonic
1167289025 19:48614588-48614610 GAGGAAGCAGCGGCCTGGGTTGG - Intronic
1202683587 1_KI270712v1_random:30376-30398 CAAAACGCCGCGGCGGGGGCGGG - Intergenic
924962129 2:45408-45430 CAGAAGGCTGGGGGCGGGGCTGG - Intronic
925619142 2:5773681-5773703 CAGAAAGCAGAGGACAGGGCTGG - Intergenic
925682735 2:6439988-6440010 CAGAGAGCAGCTTCCTGGGCTGG + Intergenic
926252503 2:11163632-11163654 CAGGAGACAGCGGCCAGGGCTGG - Intronic
927402460 2:22729027-22729049 CGAAAAGCAGCGGCCGGGCGCGG + Intergenic
929075527 2:38076427-38076449 TCGAGCGCAGCGGCCGGGGCAGG - Intronic
929501579 2:42494615-42494637 CAGAACGTGGGGGCCGGGGCCGG - Exonic
931610204 2:64090776-64090798 AAGAAAGCAGAGGCCGGGCGTGG + Intergenic
931673047 2:64665983-64666005 AAGAAAGCCGAGGCTGGGGCTGG + Intronic
932448003 2:71792355-71792377 AAGAAATCAGTGGCAGGGGCTGG - Intergenic
933911276 2:86942926-86942948 CAGAAAGCCCGGGCCAGGGCGGG - Intronic
934248096 2:90324384-90324406 CAAAAAGCAGCGGCGGCGGGGGG + Intergenic
934248175 2:90324660-90324682 CAAAAAGCCGCGGCGGCGGCGGG + Intergenic
934257878 2:91442947-91442969 CAGAAAGCGGCTGCGGGGGGAGG - Intergenic
934304448 2:91809868-91809890 CAGAAAGCCGCGGCGGCGGGGGG - Intergenic
934307553 2:91839957-91839979 CAGAAAGCCGCGGCGGCGGGGGG - Intergenic
934328809 2:92042882-92042904 CAGAAAGCCGCGGCGGCGGGGGG + Intergenic
934331526 2:92073788-92073810 CAAAAAGCCGCGGCAGCGGCGGG - Intergenic
934467039 2:94272867-94272889 CAAAAAGCCGCGGCGGCGGCGGG + Intergenic
934487555 2:94730516-94730538 CAGAATGCAGTGGCAGGAGCTGG + Intergenic
934688079 2:96335977-96335999 CTGACAGCAGAGGCCGGTGCGGG + Intronic
935312677 2:101801081-101801103 CAGAAAGCAGCAGCAGCAGCTGG - Intronic
936087542 2:109479564-109479586 GAGGAAGCAGCAGCCAGGGCAGG + Intronic
936279212 2:111122885-111122907 CAGAGCGCAGCGTCCGGGCCAGG - Intronic
937180953 2:119995862-119995884 CAGCAAGCTGCGGCCGGGCACGG - Intergenic
937242482 2:120471291-120471313 CAGATAGCAGGGGCCTGGGAAGG - Intergenic
937710816 2:124978310-124978332 CACACAGCAGCAGCCTGGGCAGG - Intergenic
937962261 2:127469234-127469256 CAGCCAGCGGGGGCCGGGGCTGG + Intronic
938266031 2:129928971-129928993 CAGAAAGCAGCAGCCATGGTGGG + Intergenic
938408081 2:131043817-131043839 GAGCAAGCAGCGGCCAGGTCAGG - Intronic
938518337 2:132038445-132038467 CAAAAAGCCGCGGCGGCGGCGGG + Intergenic
938518389 2:132038676-132038698 CAAAAACCAGCGGCGGCGGCGGG + Intergenic
939995060 2:148912186-148912208 CAGGAAGCAGGGGCAGGGGCTGG + Intronic
940102323 2:150055420-150055442 GAGAGAGAAGCGGCAGGGGCGGG - Intergenic
948459765 2:238123532-238123554 CACAGAGCAGGGGCCGGGGAGGG - Intronic
948921548 2:241068259-241068281 CAGAGAGCAGCGGCCAGCGAGGG + Intronic
948921565 2:241068331-241068353 CAGAGAGCAGCGGCCAGCGAGGG + Intronic
1168796270 20:611877-611899 CAGGAAGCAGCAGCCTGGTCTGG - Intergenic
1168829771 20:839511-839533 AAGAAAGCCGAGGCTGGGGCTGG - Exonic
1169247371 20:4034153-4034175 GGGAACGCAGCAGCCGGGGCTGG - Intergenic
1169914768 20:10673998-10674020 CTGGCAGCAGCGGCCGGGGCTGG + Exonic
1172269270 20:33644493-33644515 CAGGAAGCAGCGGCCGGCCCTGG - Exonic
1172277244 20:33686354-33686376 CAGGCAGCGGCGGCCGGGGGCGG - Exonic
1173430450 20:42982988-42983010 CAGCAAGCAGCTGCCAGTGCTGG + Intronic
1173740185 20:45394820-45394842 CAGGAAGCAGTGGCGGGGCCAGG + Intronic
1174399878 20:50270243-50270265 CAGAACGCAGCAGCTGGCGCCGG + Intergenic
1174458671 20:50667580-50667602 CTTAAAGCAGCGGCCGGGCGCGG - Intronic
1174534356 20:51239202-51239224 CAGGAAGCAGCAGCCGCAGCAGG + Intergenic
1174874953 20:54217273-54217295 CAGAAAGGGGCGGCGGGGGGCGG + Intronic
1175389604 20:58618566-58618588 CAGAAAGCAGATGACGGGGTAGG - Intergenic
1175394776 20:58650642-58650664 CAGAAAGCGGCAGCTGGGGAGGG + Intergenic
1175857126 20:62127602-62127624 CTGGAAGCAGCGGCTGAGGCTGG - Intronic
1176237037 20:64058189-64058211 GAGAAAGGAGCGGACGGGACAGG - Intronic
1176838589 21:13818392-13818414 CAGAATGCAGTGGCAGGAGCTGG + Intergenic
1178285349 21:31321133-31321155 CAGAAAGAAGGGGGCGGGGGGGG + Intronic
1179238550 21:39568391-39568413 CAGAAAGCAGCTGGAGAGGCAGG - Intronic
1179408428 21:41143823-41143845 CAGAAACGAGGGGCTGGGGCTGG + Intergenic
1179964194 21:44791623-44791645 CAGAAATCTGCTGCAGGGGCAGG + Intronic
1180534635 22:16387075-16387097 CAAAAAGCAGCGGCGGCGGGGGG - Intergenic
1181275060 22:21682989-21683011 CAGCAAACAGGGGCAGGGGCAGG - Intronic
1181652660 22:24269410-24269432 AAGAAAGCCGAGGCTGGGGCTGG - Intergenic
1181714152 22:24712250-24712272 CAGGCCGCAGCGGCTGGGGCGGG - Intergenic
1182279218 22:29208407-29208429 CAGGAAGCAGCCCCAGGGGCAGG - Intronic
1183211874 22:36456040-36456062 CAGAAAGGAGCAGCAGGTGCAGG - Intergenic
1183529701 22:38346759-38346781 CTCAAAGCAGGGGCTGGGGCAGG + Intronic
1183784908 22:40023667-40023689 CAGAGAGCGGCAGCAGGGGCAGG - Intronic
1184481985 22:44753117-44753139 GAGAAAACGGAGGCCGGGGCAGG + Intronic
1184563326 22:45276005-45276027 CAGAAAGCCGAGGCTGGGGCTGG + Intergenic
1184778980 22:46636773-46636795 CAGAAAGCAGGGGCCATGCCCGG - Intronic
1185221745 22:49632477-49632499 CGGCCAGCAGCAGCCGGGGCCGG + Intronic
1185276920 22:49953829-49953851 CAGGAAGCAGCAGCGGGGCCGGG + Intergenic
949473278 3:4418656-4418678 TAGAAAGCAGGGGCCAGAGCAGG - Intronic
950135431 3:10577499-10577521 CAGAAACCATCGGCTGGGCCAGG + Intronic
950438708 3:12994909-12994931 CAGATAGCAGAGGCTGGGCCTGG + Intronic
950546347 3:13640248-13640270 GAGAACGCTGGGGCCGGGGCCGG - Intergenic
952963699 3:38608333-38608355 CAGAGGGCAGGGGCAGGGGCAGG - Intronic
954253732 3:49389049-49389071 CAGAAAGCAGCTGCTGGGCGTGG + Intronic
954631548 3:52050534-52050556 CAGAAAGGAGCGTCCTGGACAGG + Exonic
954706403 3:52483081-52483103 AGGAGAGCAGCGGCCTGGGCAGG + Intronic
954960847 3:54563545-54563567 CACAAAGCAGAGGCCTGGGAAGG - Intronic
955818589 3:62874053-62874075 CAGAGAGCAACCGCAGGGGCAGG - Intronic
955824117 3:62926796-62926818 GAGAAAGCTGAGGCTGGGGCTGG + Intergenic
959484682 3:106913367-106913389 CAGGAAGCAGAGGCCGGGCCAGG + Intergenic
960096709 3:113696547-113696569 CAAAAAGAGGCGGCGGGGGCGGG - Exonic
960565296 3:119126029-119126051 CAGGCAGCAGCAGCCGGTGCTGG - Intronic
961781631 3:129324057-129324079 CTGAAACCAGCAGCCGGGCCAGG + Intergenic
961799963 3:129439963-129439985 CGGAAAGCAGCGGCGGCGTCTGG - Exonic
965891420 3:173519218-173519240 CAGAAAGCTGCTGCAGGGGTAGG + Intronic
967176491 3:186865657-186865679 GGGAACGCAGCAGCCGGGGCTGG - Intergenic
967900100 3:194441062-194441084 CACAAAGCAGGGGCCTGAGCTGG + Intronic
968286679 3:197513055-197513077 CAGCAGGCAGGGGCAGGGGCAGG + Intronic
968418762 4:464781-464803 TAAAAAGCAGCAGCTGGGGCTGG + Intronic
968520338 4:1032192-1032214 CAGGAAGGAGAGGCCGGGCCAGG - Intergenic
968578253 4:1377876-1377898 CACATGGCAGCGGCCCGGGCTGG + Intronic
968642541 4:1721731-1721753 GGGAAAGCGGCGGCCGGGGCGGG - Intronic
968803364 4:2756891-2756913 AAGAAAGCGGCGTGCGGGGCAGG - Intergenic
969333865 4:6495320-6495342 CAGAACACAGCAGCTGGGGCAGG + Intronic
969431704 4:7158949-7158971 CAGAAAGCAGAGTCTGAGGCTGG + Intergenic
969498668 4:7540227-7540249 CAGGAAGGAGAGGCAGGGGCAGG - Intronic
971105498 4:23519798-23519820 CACACAGCAGCAGCTGGGGCAGG + Intergenic
971191228 4:24430825-24430847 CAGAAAGTAGGGGCCGGGCGCGG + Intergenic
971859370 4:32085452-32085474 CAGGAAGCAGCAGCAGGGTCAGG - Intergenic
976398469 4:84582790-84582812 CAGCACGCAGAGGCGGGGGCGGG + Intergenic
977315947 4:95447915-95447937 CAGGAAGAAGCGGCTTGGGCTGG + Intronic
978086301 4:104659351-104659373 CAGAAAGAAGTGGCCGGGTGCGG - Intergenic
983221236 4:165046194-165046216 AAGAAAGCTGAGGCTGGGGCTGG + Intergenic
985542855 5:494845-494867 TAGAAAACAGCGGCCTGGGTGGG - Intronic
985708095 5:1413338-1413360 CAGAAAGCCAGGGTCGGGGCTGG - Intronic
985720995 5:1489017-1489039 CTGAAAGCAGCCTGCGGGGCTGG - Intronic
988547612 5:32173611-32173633 CAGAAAGCACCAGCCGCGCCAGG + Intronic
990032225 5:51275648-51275670 AAGAAAGCCGCGGTTGGGGCTGG + Intergenic
990369383 5:55101951-55101973 CAGGAAGCAGGGGTCGGGGGGGG + Intergenic
991728436 5:69560098-69560120 CAGAGTGCAGCTGCCGGAGCGGG - Intergenic
991804865 5:70415245-70415267 CAGAGTGCAGCTGCCGGAGCGGG - Intergenic
991866519 5:71067777-71067799 CAGAGTGCAGCTGCCGGAGCGGG + Intergenic
993503936 5:88689790-88689812 GCGAAAGCAGCAGCCGGGGCGGG - Intergenic
995512053 5:112920068-112920090 CATAAAGCAGAGCCCGGGGTAGG + Intronic
996893796 5:128455927-128455949 CAGACAGCAGCAGCTGGAGCTGG - Intronic
999593114 5:153170888-153170910 CATAAAGCTGAGGCCTGGGCTGG + Intergenic
1001999628 5:176190449-176190471 CAGAACCCAGGGGCCGGGGGAGG + Intergenic
1002428857 5:179191620-179191642 CAGCAAGCAGCTGCCGGGGTGGG + Intronic
1003220305 6:4155241-4155263 CAGAAAACAGAGGAAGGGGCTGG + Intergenic
1003290880 6:4776917-4776939 CAGCAAACTGCGGCCGCGGCGGG - Intronic
1006101852 6:31690444-31690466 GAGAAAGCAGAGGCCAGGGGAGG + Intronic
1006256009 6:32832784-32832806 CAGGATGCAGTGGCCAGGGCGGG - Exonic
1006495256 6:34418391-34418413 AAGAAAGCCGAGGCTGGGGCTGG - Exonic
1006591609 6:35162124-35162146 TGGAAAGCAGTGGCCGGGGCTGG + Intergenic
1007770236 6:44186257-44186279 AAGAAGGCAGGGGCCAGGGCTGG - Intergenic
1009684366 6:66936988-66937010 CAGAAAGCAGCGGCAGGGCCAGG + Intergenic
1014018858 6:116565486-116565508 CCGAAAGCAGCCGCAGGGCCAGG - Intergenic
1017681581 6:156869992-156870014 CAGGGAGCAGTGGCTGGGGCAGG + Intronic
1018056484 6:160056605-160056627 CAGAAAGAAGGGGCAGGGGTCGG - Intronic
1018205833 6:161436289-161436311 CAGAGAGCAGGGGCCGGGATGGG + Intronic
1019047874 6:169162092-169162114 CAGAAAGCTGCACACGGGGCGGG - Intergenic
1019323286 7:425174-425196 AAGAAAGCAGCGGCCGCCCCTGG - Intergenic
1020115380 7:5473285-5473307 CAGAACGGAGCGGCCAGGGTGGG - Intronic
1023169413 7:37375937-37375959 AAGAAAGTAGAGGCTGGGGCTGG + Intronic
1024064229 7:45719179-45719201 CAGGAAGCAGCTGCCCTGGCTGG - Exonic
1024096278 7:45985302-45985324 CACAAAGCACCAGCAGGGGCAGG + Intergenic
1024641636 7:51333759-51333781 CACTCAGCAGCGGCCAGGGCCGG + Intergenic
1025561665 7:62379467-62379489 CAAAAAGCCGCGGCGGGGGTGGG - Intergenic
1025561873 7:62380262-62380284 CAAAAAGCAGCGGCGGCGGCCGG - Intergenic
1025853598 7:65260312-65260334 GGGAACGCAGCAGCCGGGGCTGG - Intergenic
1025884354 7:65572760-65572782 CAGAAAGCCGTGGCAGCGGCGGG + Intergenic
1027211897 7:76156089-76156111 CAGAAAGCTGAGGCCGAGGCAGG + Intergenic
1028984114 7:96996692-96996714 CAGGCAGCCCCGGCCGGGGCAGG + Intergenic
1029262791 7:99314757-99314779 CTGAAACCATCTGCCGGGGCGGG - Intergenic
1031870924 7:127089544-127089566 CAGAAAGCAGAGCCCAGAGCTGG + Intronic
1032041907 7:128570305-128570327 AAGAAAGCCGAGGCTGGGGCTGG - Intergenic
1034560481 7:151876677-151876699 CCGAAGGCAGCGGCCGGGGGAGG - Exonic
1035297297 7:157874370-157874392 CAGAAAGCAGGAGCTGGGTCAGG - Intronic
1036091700 8:5672587-5672609 AAGAAAGCAGCGGCCGGGCACGG - Intergenic
1036518148 8:9465225-9465247 AAGAAAGCAGGGGCCGGGCATGG + Intergenic
1037003349 8:13747619-13747641 CAGAAATCTGCTGCAGGGGCTGG - Intergenic
1037535304 8:19817770-19817792 GAGAAAGCAGGGGGCCGGGCAGG - Intronic
1037545967 8:19922780-19922802 AAGAAAGCAGAGGCCGGGCGTGG + Intronic
1038571529 8:28666869-28666891 AAGAAAGGAGTGGCTGGGGCTGG - Intronic
1039180185 8:34858307-34858329 CAGAAAGCATCGGTGGGGGCGGG - Intergenic
1042561057 8:70072189-70072211 CCGAAGGCCGCGCCCGGGGCGGG - Intergenic
1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG + Exonic
1044963802 8:97556480-97556502 CTGAAAGCAGAGGTCAGGGCAGG + Intergenic
1045215410 8:100144639-100144661 AAAAAAGCAGCGGCCGGGCGCGG + Intronic
1047004803 8:120609434-120609456 CAGGCAGCAGGGGCTGGGGCAGG + Intronic
1047761569 8:127958527-127958549 CAGAAAGCATGGGCCGGGCATGG - Intergenic
1048072041 8:131031244-131031266 CAAAAAGCAGCTCCCTGGGCAGG + Intronic
1049105211 8:140608534-140608556 AAGCAAGCAGGGACCGGGGCGGG + Intronic
1049493385 8:142916760-142916782 GAGAAAGCAGCCGCCGAGGTTGG + Intronic
1049532120 8:143159998-143160020 CAGGAATGAGCGGCAGGGGCGGG + Intronic
1052993545 9:34536986-34537008 CAGAAGGCAGGGGCAGCGGCTGG - Intergenic
1053620508 9:39809674-39809696 CAAAAACCAGAGGCCGGGGAAGG + Intergenic
1053626195 9:39874260-39874282 CAAAAACCAGAGGCCGGGGAAGG - Intergenic
1053670250 9:40353896-40353918 CAGAATGCAGTGGCAGGAGCTGG - Intergenic
1053697452 9:40650916-40650938 CAAAAAGCCGCGGCGGCGGCGGG + Intergenic
1053697466 9:40650959-40650981 CAGAAAGCCGCGGCGGCGGGGGG + Intergenic
1053697514 9:40651134-40651156 CAGAAAGCCGCGGCGGCGGTCGG + Intergenic
1053697539 9:40651223-40651245 CAAAAAGCTGCGGCGGCGGCGGG + Intergenic
1053697551 9:40651266-40651288 CAGAAAGCCGCGGCGGAGGGGGG + Intergenic
1053697559 9:40651308-40651330 CAAAAAGCCGCGGCGGCGGCGGG + Intergenic
1053697582 9:40651373-40651395 CAGAAAGCCGCGGCTGTGGGGGG + Intergenic
1053697597 9:40651432-40651454 CAGAAAGCCGTGGCGGCGGCGGG + Intergenic
1053697631 9:40651544-40651566 CAAAAAGCCGCGGCGGCGGCGGG + Intergenic
1053920038 9:42980156-42980178 CAGAATGCAGTGGCAGGAGCTGG - Intergenic
1054217693 9:62376441-62376463 CAAAAACCAGAGGCCGGGGAAGG + Intergenic
1054263651 9:62897769-62897791 CAAAAACCAGAGGCCGGGGAAGG - Intergenic
1054308741 9:63450316-63450338 CAAAAAGCCGCGGCGGCGGCGGG + Intergenic
1054308755 9:63450359-63450381 CAGAAAGCCGCGGCGGCGGGGGG + Intergenic
1054308806 9:63450543-63450565 CAGAAAGCCGCGGCGGCGGTCGG + Intergenic
1054308831 9:63450632-63450654 CAAAAAGCTGCGGCGGCGGCGGG + Intergenic
1054308843 9:63450675-63450697 CAGAAAGCCGCGGCGGAGGGGGG + Intergenic
1054308851 9:63450717-63450739 CAAAAAGCCGCGGCGGCGGCGGG + Intergenic
1054308875 9:63450782-63450804 CAGAAAGCCGCGGCGGTGGGGGG + Intergenic
1054308890 9:63450841-63450863 CAGAAAGCCGTGGCGGCGGCGGG + Intergenic
1054308923 9:63450952-63450974 CAAAAAGCCGCGGCGGCGGCGGG + Intergenic
1054381371 9:64493884-64493906 CAGAATGCAGTGGCAGGAGCTGG - Intergenic
1054407427 9:64774076-64774098 CAAAAAGCCGCGGCGGCGGCGGG + Intergenic
1054407439 9:64774119-64774141 CAGAAAGCCGCGGCGGCGGTGGG + Intergenic
1054407464 9:64774208-64774230 CAAAAAGCTGCGGCGGCGGCGGG + Intergenic
1054407482 9:64774276-64774298 CAAAAAGCCGCGGCGGCGGCGGG + Intergenic
1054440787 9:65258664-65258686 CAGAAAGCCGTGGCGGCGGCGGG + Intergenic
1054440852 9:65258889-65258911 CAAAAAGCCGCGGCGGCGGCGGG + Intergenic
1054489425 9:65762598-65762620 CAAAAAGCCGCGGCGGCGGCGGG - Intergenic
1054514363 9:66022401-66022423 CAGAATGCAGTGGCAGGAGCTGG + Intergenic
1054775574 9:69121390-69121412 CAGAGAGCAGCGGCGGGGAGGGG - Intronic
1054785824 9:69209427-69209449 CAGAAAGCAGAAACCGGGTCGGG - Intronic
1055829148 9:80359481-80359503 CAGCAGGGAGCAGCCGGGGCTGG + Intergenic
1056475212 9:86946481-86946503 GAGAAAGAGGCGGCCGAGGCCGG + Exonic
1056597133 9:88016710-88016732 AAGAAAGCTGAGGCTGGGGCTGG + Intergenic
1057115279 9:92514916-92514938 CAGAAAGCAGAGGCCTGGAGAGG - Exonic
1057225014 9:93288603-93288625 CAGGAAGCAGCAGCCAAGGCTGG + Intronic
1059348226 9:113646694-113646716 CAGGAGGCAGGGGCCAGGGCAGG - Intergenic
1059825790 9:118027504-118027526 CAGAAGGAAGGGGCGGGGGCAGG - Intergenic
1060584426 9:124777288-124777310 GAAGGAGCAGCGGCCGGGGCGGG - Exonic
1060644139 9:125263644-125263666 AAGAAAGCTGAGGCTGGGGCTGG - Intronic
1061232047 9:129320796-129320818 GAGCAGGCAGCCGCCGGGGCTGG - Intergenic
1061448545 9:130656050-130656072 CTGGAAGCAGAGGCCGGGGGAGG + Intergenic
1061693632 9:132355068-132355090 CAGAAAGCAGCGGCCGGGGCGGG - Intergenic
1062325412 9:136010359-136010381 CAGGAGGCAGCGGCCAGGGCTGG - Exonic
1062536257 9:137022310-137022332 CAGAAGGGAGTGGCCAGGGCTGG + Intronic
1062620624 9:137419867-137419889 CAGAAAAAAGCGGCCGGGCGCGG + Intronic
1202779803 9_KI270717v1_random:24229-24251 CAAAAAGCCGCGGCGGCGGCGGG + Intergenic
1202779817 9_KI270717v1_random:24272-24294 CAGAAAGCCGCGGCGGCGGGGGG + Intergenic
1202779862 9_KI270717v1_random:24431-24453 CAGAAAGCCGCGGCGGCGGTCGG + Intergenic
1202779887 9_KI270717v1_random:24520-24542 CAAAAAGCTGCGGCGGCGGCGGG + Intergenic
1202779899 9_KI270717v1_random:24563-24585 CAGAAAGCCGCGGCGGAGGGGGG + Intergenic
1202779907 9_KI270717v1_random:24605-24627 CAAAAAGCCGCGGCGGCGGCGGG + Intergenic
1202779931 9_KI270717v1_random:24670-24692 CAGAAAGCCGCGGCGGTGGGGGG + Intergenic
1202779944 9_KI270717v1_random:24728-24750 CAGAAAGCCGTGGCGGCGGCGGG + Intergenic
1202779996 9_KI270717v1_random:24905-24927 CAAAAAGCCGCGGCGGCGGCGGG + Intergenic
1203612890 Un_KI270749v1:26666-26688 CAAAAAGCGGCGGCGGCGGCGGG - Intergenic
1185454127 X:299215-299237 CCGAGAGCAGTGCCCGGGGCCGG + Exonic
1187127951 X:16471296-16471318 CAGAAAGCAGGATCGGGGGCTGG + Intergenic
1187801196 X:23065022-23065044 CAAAAAACAGCGGCCGGGCATGG + Intergenic
1188217584 X:27497855-27497877 CAGAAAGCAGAGGCCGAGTGCGG - Intergenic
1189380588 X:40499891-40499913 CAGAACGCAGGGGCCTGAGCGGG - Intergenic
1192153111 X:68724172-68724194 CAGAAAGTAGGGGCAGAGGCAGG - Intronic
1193148805 X:78104167-78104189 CCGAGAGCAGCGGCCGGGAAGGG + Exonic
1194548881 X:95272419-95272441 CAGAAATCTGCTGCAGGGGCAGG - Intergenic
1196757563 X:119171281-119171303 CAGAAAGCAGCATCCGAGGAAGG - Intergenic
1196820297 X:119695407-119695429 CAGAAAGCTGCTGCCGGAACGGG + Intergenic
1200100708 X:153688144-153688166 CTGCAAGCGGCGGCCGGAGCAGG - Exonic
1200953949 Y:8927184-8927206 CAGGAAGCAGCTCCCTGGGCTGG + Intergenic
1202199398 Y:22331028-22331050 CAGGAAGCAGCTCCCTGGGCTGG + Intronic