ID: 1061698066

View in Genome Browser
Species Human (GRCh38)
Location 9:132392968-132392990
Sequence TGTCAGAGTAAAACACATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 210}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061698066_1061698069 27 Left 1061698066 9:132392968-132392990 CCAGCATGTGTTTTACTCTGACA 0: 1
1: 0
2: 2
3: 21
4: 210
Right 1061698069 9:132393018-132393040 TTCAAATGTTCCACAGGCCCAGG No data
1061698066_1061698068 21 Left 1061698066 9:132392968-132392990 CCAGCATGTGTTTTACTCTGACA 0: 1
1: 0
2: 2
3: 21
4: 210
Right 1061698068 9:132393012-132393034 CTACATTTCAAATGTTCCACAGG No data
1061698066_1061698070 30 Left 1061698066 9:132392968-132392990 CCAGCATGTGTTTTACTCTGACA 0: 1
1: 0
2: 2
3: 21
4: 210
Right 1061698070 9:132393021-132393043 AAATGTTCCACAGGCCCAGGAGG No data
1061698066_1061698067 -7 Left 1061698066 9:132392968-132392990 CCAGCATGTGTTTTACTCTGACA 0: 1
1: 0
2: 2
3: 21
4: 210
Right 1061698067 9:132392984-132393006 TCTGACAGCACATCTCAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061698066 Original CRISPR TGTCAGAGTAAAACACATGC TGG (reversed) Intronic
903512739 1:23888620-23888642 TGTAAGAGTAAAAGAGAAGCGGG + Intronic
903582026 1:24378154-24378176 TGGAAGAATAAAACACATACTGG + Intronic
905246212 1:36615869-36615891 TGTCAGTGTGATACACATGGTGG + Intergenic
905946454 1:41905207-41905229 TTTCAGAGTAACAGACATTCAGG + Intronic
907502173 1:54888712-54888734 TTTAAGAGTAAAACACACACTGG + Intergenic
907769910 1:57451175-57451197 TGCCAAAGTAAGACAAATGCAGG - Intronic
908668360 1:66517792-66517814 TGTCAAAATATAACAGATGCTGG + Intergenic
909395493 1:75167034-75167056 TCTCAGATTAGAACACAAGCAGG - Intergenic
912904131 1:113685932-113685954 TGTGACAGTAAAAGAAATGCAGG - Intergenic
914464819 1:147917591-147917613 TATCAGAGAAAAACAGATGCTGG - Intergenic
918421883 1:184372478-184372500 TGTACGTGTAAAATACATGCTGG + Intergenic
918707176 1:187679211-187679233 TTTCAGATAAAAACACATTCAGG + Intergenic
920004083 1:202820115-202820137 TGTCAGAGGAATGCACATGCAGG - Intergenic
920646997 1:207811179-207811201 TAGCAAAATAAAACACATGCAGG - Intergenic
1064357867 10:14635930-14635952 TTTCAGTGGAAAACACATTCTGG - Intronic
1064779975 10:18824504-18824526 AGTCAGAAAAAAACAGATGCTGG - Intergenic
1064843943 10:19629858-19629880 TGACATAGTTAAACTCATGCTGG - Intronic
1065311460 10:24419736-24419758 TGCCAGAGCTAACCACATGCTGG + Intronic
1066153338 10:32648666-32648688 TGTCAAAGAATAACAGATGCTGG - Intronic
1067030438 10:42875881-42875903 TGTTAAATTAAAACAAATGCCGG - Intergenic
1069077005 10:64048640-64048662 AGTCAGAGAATAACAGATGCTGG + Intergenic
1071761919 10:88617193-88617215 TGACAGAGTAAGAAACATGGAGG + Intergenic
1074930400 10:118119337-118119359 CCTCAAAGTAAAACATATGCAGG - Intergenic
1075852774 10:125602552-125602574 AGTCAGAGTAATACAGCTGCCGG - Intronic
1077778589 11:5299317-5299339 TGTAAGAGTAAAAAACATAGCGG - Intronic
1078140099 11:8686055-8686077 ATTCAGAGTACAATACATGCAGG - Exonic
1078538437 11:12193887-12193909 AGTCAGAGTTCAGCACATGCTGG + Intronic
1080607784 11:33877936-33877958 TGTGGCAGTAAAACACATGAGGG - Intronic
1082920878 11:58492421-58492443 TGGCAGAGTTATACACATTCTGG + Intergenic
1087842764 11:102937004-102937026 TGTCAGAAAATAACAGATGCTGG + Intergenic
1088089843 11:106024673-106024695 TGTAAGTGTAAAATATATGCAGG + Intergenic
1089506822 11:118969041-118969063 AGTCAGAAAATAACACATGCTGG + Intergenic
1090319109 11:125826089-125826111 TATCTGAGTAAAACAAATTCTGG + Intergenic
1093448308 12:19285870-19285892 TCTCACAGTAAAACACATGATGG + Intronic
1093750846 12:22798320-22798342 TGATAGAGTAAAACTCATTCCGG - Intergenic
1094056048 12:26270596-26270618 TGTGGTTGTAAAACACATGCAGG + Intronic
1098058284 12:66532713-66532735 TCCCAGAGTAAATCACATGGAGG + Intronic
1099036395 12:77592669-77592691 TGAAAAAGTACAACACATGCAGG - Intergenic
1102287143 12:111667401-111667423 TGTCACATTAAAAAAGATGCCGG + Intronic
1104382437 12:128319307-128319329 AGTCAGAGAAAAAAAGATGCAGG - Intronic
1104967496 12:132514953-132514975 TGTAAATGTAAAACACCTGCTGG - Intronic
1105512747 13:21064417-21064439 TGTTCAAGAAAAACACATGCTGG + Intergenic
1105540597 13:21312923-21312945 TGTCATAGTAAAACACATGAAGG + Intergenic
1106431146 13:29681747-29681769 TGTCAGAGGGAAACAAATGCAGG - Intergenic
1107353171 13:39537405-39537427 TGCCAGAGGCAGACACATGCTGG - Intronic
1107397805 13:40035624-40035646 AGCCAGAACAAAACACATGCAGG - Intergenic
1108120431 13:47179929-47179951 TGTCCTAGTAAAACACCTGTAGG - Intergenic
1108263733 13:48683382-48683404 AGTCAAAGAAAAACAGATGCTGG - Intronic
1109626964 13:64986852-64986874 TGTCAGGAAACAACACATGCTGG - Intergenic
1111137871 13:84073562-84073584 TGTGACAGTAAAACACGTGAAGG + Intergenic
1114055609 14:18965098-18965120 TGTAACAGTCAAACACAAGCAGG - Intergenic
1114106937 14:19436665-19436687 TGTAACAGTCAAACACAAGCAGG + Intergenic
1115874536 14:37845500-37845522 TGTCAGAGTGGAGCACATACGGG - Intronic
1116770962 14:49126498-49126520 TGTCAGGGAACAACAGATGCTGG - Intergenic
1117005172 14:51413811-51413833 AGTCAGGGTACAACAGATGCTGG - Intergenic
1117013795 14:51497721-51497743 TGTAAGTGTAAAATACATGCTGG - Intronic
1117270040 14:54134365-54134387 AGAAAGAGTAAAGCACATGCTGG + Intergenic
1117496112 14:56306347-56306369 TCTCAGAGTAAAAAACAGACAGG - Intergenic
1118790889 14:69091736-69091758 TGTCAAACTGAAACACAGGCAGG + Exonic
1120051592 14:79873364-79873386 TGCCAGAGGAAACCACATTCTGG + Intergenic
1120124228 14:80721433-80721455 TCTAAGGGTAAAATACATGCCGG + Intronic
1120484718 14:85098671-85098693 TGACAGAGTAAAAGAAATGGAGG - Intergenic
1121956207 14:98215769-98215791 TGTCTGAACAAAACACATGCCGG - Intergenic
1124220290 15:27845343-27845365 TTTCAGAGAAAAACACAAGTGGG + Intronic
1124432960 15:29622747-29622769 GGACAAAATAAAACACATGCCGG - Intergenic
1126524686 15:49638804-49638826 TGTCAAAATAAAACACTTGAAGG + Intronic
1127452074 15:59126199-59126221 TGTCAGGGAACAACAGATGCTGG - Intergenic
1127655366 15:61050637-61050659 TGTAAGAGTAAAACATACACAGG + Intronic
1127741917 15:61916644-61916666 TGTCAGATAAAAAAACATGTAGG + Intronic
1134793272 16:17010719-17010741 TGTAAGTGTCAAAGACATGCTGG + Intergenic
1135511513 16:23088559-23088581 TGTGAGAGTAGGACACATTCAGG - Intronic
1137753345 16:50882665-50882687 GGTCATAGTAAAACTCATGAGGG - Intergenic
1141854101 16:86669474-86669496 TGTCAGGGAAAAGCACCTGCAGG - Intergenic
1143661861 17:8329572-8329594 TGTCAGAGTGAAAAGCAAGCTGG + Intergenic
1143746104 17:8995348-8995370 TGACAGAGTATAACAAAGGCTGG - Intergenic
1143938167 17:10508882-10508904 TGACAGAGTAAGACAGATGAAGG + Intronic
1151377850 17:73703541-73703563 TGACAGGGTAGAGCACATGCGGG - Intergenic
1156319646 18:36007070-36007092 TTTGAGAGTAAAACACAGGGTGG - Intronic
1157230814 18:45914269-45914291 TGTCAGAGGGAAAGGCATGCTGG + Intronic
1157327860 18:46681846-46681868 TGTGAGTGTAAAACACACACTGG - Intronic
1157367741 18:47081481-47081503 TGTAAGTGTAAAATATATGCTGG - Intronic
1159302862 18:66598135-66598157 TGTCAGAATATAACAGATGCTGG + Intronic
1160010651 18:75105198-75105220 CCACAGAGTAAAACACAAGCAGG - Intergenic
1161696380 19:5770989-5771011 GGTAGGAGTAAAACACGTGCAGG - Exonic
1162238459 19:9326772-9326794 TGTAAGTGTAAAATACGTGCAGG - Intronic
1165874378 19:38995518-38995540 TGTCAGAATAGACCACCTGCAGG + Intronic
1167451398 19:49572038-49572060 TGAAAGAGTAAAATACATTCTGG - Intronic
1167710273 19:51106195-51106217 TGTCAGAGTAAACGACATCAAGG - Intronic
925072968 2:985600-985622 TTTCAGAGAGAAACAGATGCTGG + Intronic
927429635 2:23016409-23016431 TGTTAGAGTAAATCAGATTCAGG - Intergenic
928610709 2:32989509-32989531 GGTCAGAGTAAAGCATATACTGG - Intronic
931971735 2:67594380-67594402 TGTCAGGGAACAACAGATGCTGG + Intergenic
932134294 2:69214771-69214793 AGTCAGTGTTAAACACAGGCTGG - Intronic
932264487 2:70355487-70355509 TGACACAGCAAAACACATGGAGG + Intergenic
933823973 2:86141696-86141718 TTTCAGAGTAAAACAGATTGAGG + Exonic
935474317 2:103499494-103499516 TGTCAGAGTAAAAACCTTTCTGG - Intergenic
938051225 2:128174114-128174136 TGTCAAAAGAAAAAACATGCTGG + Intronic
938580499 2:132641551-132641573 TGTAAGAGTAAAACCTATACTGG + Intronic
941288808 2:163649162-163649184 TGTCAAAATACAACACAAGCAGG + Intronic
942383829 2:175420956-175420978 TATCAGAATAAAACCAATGCTGG + Intergenic
942493563 2:176514503-176514525 TTTCAGGGTCAAAAACATGCAGG - Intergenic
944299320 2:198104693-198104715 AGTCAGAAAATAACACATGCTGG - Intronic
945338595 2:208622167-208622189 TGGCAGTGAAAAACACATGCTGG - Intronic
945856960 2:215080693-215080715 TGTAAGAGTAAATGATATGCCGG + Intronic
947132730 2:226945810-226945832 TGTCAGTAAAAAACAGATGCTGG - Intronic
948706173 2:239794059-239794081 TGTCAGAGAAACACACATGAAGG - Intronic
1171818337 20:29809150-29809172 AGTCAGTGAAAAACAAATGCTGG - Intergenic
1171899466 20:30843853-30843875 AGTCAGTGAAAAACAAATGCTGG + Intergenic
1173029016 20:39337254-39337276 TGTAAGTGTAAAATACACGCTGG + Intergenic
1174833102 20:53831823-53831845 TGTGAGAGTAAAACACACACTGG - Intergenic
1174929423 20:54796163-54796185 AGACAGAGTAAACCACATGTAGG - Intergenic
1176362574 21:6010248-6010270 TGTAAGAGCAAAACAAATGCAGG + Intergenic
1179675255 21:42976325-42976347 TGTCAAAGTATAAAACAAGCAGG - Intronic
1179760944 21:43528297-43528319 TGTAAGAGCAAAACAAATGCAGG - Intergenic
1180228740 21:46413700-46413722 TTTCAAAGTAAAACAGACGCTGG - Intronic
1180333279 22:11552133-11552155 AGTCAGTGAAAAACAAATGCTGG + Intergenic
1180474085 22:15687650-15687672 TGTAACAGTCAAACACAAGCAGG - Intergenic
950562447 3:13742113-13742135 TGTGAGAGGAAAACAAATGAGGG - Intergenic
950793070 3:15488834-15488856 TGTAAGTGTAAAATACATACTGG - Intronic
950915712 3:16643170-16643192 TGTTAGAGTAAAAAACAAACTGG - Intronic
952662952 3:35873822-35873844 TATTACAGTATAACACATGCAGG - Intergenic
952708665 3:36406588-36406610 TGACACATTATAACACATGCTGG - Intronic
953831283 3:46299541-46299563 CATCAGAGGAAAACACATCCAGG + Intergenic
954494504 3:50942881-50942903 TGTAAGTATAAAATACATGCTGG + Intronic
957346275 3:78964962-78964984 TCTCAGAGTGAAACATAGGCTGG - Intronic
959207141 3:103323738-103323760 AGTCAGAATATAACAGATGCTGG - Intergenic
959771028 3:110096576-110096598 AATCATAGTAAAACACATGTTGG - Intergenic
961064200 3:123860795-123860817 TGTCAGAGTAAAATGCATAGGGG + Intronic
963169777 3:142239215-142239237 TGACAAAGTAATTCACATGCTGG + Intergenic
964863163 3:161224124-161224146 TGTCACATTAAAACAAATGGAGG - Intronic
965493512 3:169369126-169369148 AGTAAGAGTAATAGACATGCTGG + Intronic
970404091 4:15745834-15745856 TGCCTTATTAAAACACATGCAGG - Intergenic
970615391 4:17764014-17764036 TGACAGAGTAAAAAACATGTAGG - Intronic
970874272 4:20851207-20851229 TGCCAGGGAACAACACATGCTGG - Intronic
971989256 4:33869684-33869706 AGTCAGAAAACAACACATGCTGG + Intergenic
972241657 4:37199613-37199635 AGTCAAAGAATAACACATGCTGG - Intergenic
975822337 4:78284739-78284761 TGTCAGAAAAAAAGACCTGCAGG - Intronic
977294199 4:95193070-95193092 TAGCAGAGTGAAACACATCCTGG - Intronic
977467243 4:97398035-97398057 TGTCAGGAAACAACACATGCTGG - Intronic
979109379 4:116732697-116732719 TGTGAGAGTAAAAAACAGGTAGG - Intergenic
981066087 4:140487628-140487650 TGTGAGTGTAAAATACACGCAGG - Intronic
982907084 4:161088155-161088177 AGTCAGAAAAGAACACATGCTGG + Intergenic
983476109 4:168213673-168213695 TGTCAGGAAACAACACATGCTGG - Intergenic
986967277 5:13289068-13289090 AGTCAAAATAAAACAGATGCTGG - Intergenic
987060981 5:14243649-14243671 TGTATGAGGAAAACAAATGCTGG - Intronic
987538912 5:19228123-19228145 TATCAGAGAAAAACACTTACAGG + Intergenic
988338001 5:29931052-29931074 TGTAAGTGTAAAACACTTACAGG + Intergenic
989139404 5:38188527-38188549 GGTCAGAGTAGAACACAGGCTGG - Intergenic
989267909 5:39499029-39499051 TGTAAGAGTAGAGCACAGGCAGG + Intergenic
989530888 5:42507072-42507094 TGTCAGAGAAAGAAACATACAGG - Intronic
989671919 5:43928201-43928223 AGTCAGGGAACAACACATGCTGG + Intergenic
990479903 5:56200138-56200160 TGTCAGAATAAACCAAATTCAGG + Intronic
993366289 5:87037694-87037716 TGTCAGGGAACAACAGATGCTGG - Intergenic
995358973 5:111271379-111271401 TGTGAGAGTAAATCACTTGATGG + Intronic
995990639 5:118234651-118234673 AGTCAGATTATAACACAAGCAGG + Intergenic
996746253 5:126848563-126848585 TGTCAGAGACCAACACGTGCTGG - Intergenic
998432657 5:142079790-142079812 TGTAAGTGTAAAACACACACTGG + Intergenic
999562524 5:152820167-152820189 TATCAGAGTAAATCATATGGGGG + Intergenic
1003788531 6:9515676-9515698 TGTCAGTGAAAAACACACACAGG - Intergenic
1004290420 6:14362053-14362075 TGTAAGTGGAAAATACATGCAGG - Intergenic
1005664079 6:28032229-28032251 TGTAAGTGTAAAACAGATCCAGG - Intergenic
1005777385 6:29149967-29149989 AGTCAGAGAAGAACAGATGCTGG - Intergenic
1007103155 6:39264897-39264919 TGTGAAAGTATAGCACATGCAGG + Intergenic
1007454348 6:41964865-41964887 TGTGAGAATAAAAGAAATGCAGG + Intronic
1007742858 6:44023321-44023343 GGTCAGAGGGAAACAAATGCAGG + Intergenic
1010556442 6:77285144-77285166 TGTTAGAGAAAAACACAGGATGG - Intergenic
1010807063 6:80249919-80249941 TTTCAGAGCAACACACATACAGG - Intronic
1012938618 6:105393955-105393977 TGTAAGCATAAAATACATGCTGG - Intronic
1015078835 6:129197811-129197833 TGTAAAAGTAACACAAATGCAGG + Intronic
1015653623 6:135492808-135492830 TGACACAGTAATACACATCCAGG - Intronic
1017910020 6:158784575-158784597 AGTCACAGGAAAAGACATGCTGG + Intronic
1021298143 7:18935146-18935168 TGTCAGAGAAAGGCACATGGGGG + Intronic
1022532312 7:31074715-31074737 TGTCACAGCCAAGCACATGCTGG + Intronic
1022829099 7:34046779-34046801 TTTCAGAGTCAAAACCATGCAGG + Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1024968622 7:55048455-55048477 TATCAGGGTAAAAAAGATGCAGG - Intronic
1026048665 7:66926042-66926064 TATCAAAGAAAAACAAATGCTGG - Intronic
1026179376 7:68025256-68025278 TTTTAGATTCAAACACATGCAGG + Intergenic
1027433707 7:78141382-78141404 TGTCACAATAAAACATATGAAGG - Intronic
1030781578 7:113607432-113607454 TGTAAGTGTAAAACACTTGCTGG + Intergenic
1031299019 7:120041074-120041096 AGTCAGATTAACACACATGATGG + Intergenic
1034645910 7:152647059-152647081 TGTCAGAAAATAACAGATGCTGG - Exonic
1034828140 7:154285883-154285905 TGTCAGAATGAAAAACACGCCGG - Intronic
1034964302 7:155382232-155382254 TGTCAGAGAAAAACAGAAGTGGG + Exonic
1036467899 8:9018887-9018909 TGTCAGGGTAAAACACAAGATGG - Intronic
1037383377 8:18312080-18312102 TGTCAGAGTAAAACCAATACAGG + Intergenic
1040399662 8:47035973-47035995 TGTCACAGAAAAACAGAAGCAGG + Intergenic
1040408768 8:47134258-47134280 TGTGACAGTCAAACACAAGCGGG + Intergenic
1041868176 8:62600626-62600648 TGTCATAGAGAAACAAATGCAGG - Intronic
1041912649 8:63105134-63105156 TGTTAGGGTAAAAAAAATGCTGG + Intergenic
1043232249 8:77817775-77817797 TGTTAGAGAGGAACACATGCAGG + Intergenic
1043559183 8:81470447-81470469 TGTCAGAGCAATAAACATGAAGG - Intergenic
1044045943 8:87432152-87432174 TGTAGGAGGAAAACACATACAGG - Intronic
1044260531 8:90114751-90114773 TGTCAGTGGAAGACACATGTGGG - Intergenic
1044521120 8:93200350-93200372 TGTCAGGAAAAAACAGATGCTGG - Intergenic
1044536748 8:93365594-93365616 TGTCAGTTTAAAAAAAATGCAGG - Intergenic
1044823614 8:96176390-96176412 GGTGAGAGTAAAACACAGGAAGG - Intergenic
1044937842 8:97310068-97310090 TGTAAGATTAAAATACATGCTGG + Intergenic
1045581689 8:103488155-103488177 TGGCAGAGTAAAGGACATGGAGG + Intergenic
1045778406 8:105834478-105834500 TTTCACAGTTAAAAACATGCAGG + Intergenic
1046305103 8:112356021-112356043 AGTCAGAGAAAAACAGATGGTGG + Intronic
1046572254 8:115981118-115981140 AGTCAGAAAAAAACAGATGCTGG + Intergenic
1046757734 8:117989121-117989143 TTTCAGAGGAAAACAAATGAAGG + Intronic
1048730625 8:137436639-137436661 TGTCTGATGAAAAAACATGCTGG - Intergenic
1048931569 8:139319430-139319452 TTTCAGAGTATAAGACAGGCAGG + Intergenic
1052358756 9:27531117-27531139 TGTGTGAGTAGAACACGTGCTGG - Intergenic
1055754195 9:79540003-79540025 AGTCAGGGTACAACAGATGCTGG + Intergenic
1059250711 9:112885625-112885647 TGTAAGTGTAAAATACATACTGG + Intronic
1059832055 9:118107250-118107272 TGTTAGAGTAGAAAACATGCTGG + Intergenic
1059960160 9:119556755-119556777 TGTCAGCTGAATACACATGCAGG + Intergenic
1061698066 9:132392968-132392990 TGTCAGAGTAAAACACATGCTGG - Intronic
1061772763 9:132939318-132939340 TGTGAGAGTAAAACAGCTGATGG + Intronic
1061783665 9:133010311-133010333 TTTAAAAGTATAACACATGCTGG + Intergenic
1061963621 9:134000731-134000753 TATCAGTGCAAACCACATGCTGG - Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1203777031 EBV:79004-79026 TCCCAGAGTAAAACACGTACAGG + Intergenic
1186280040 X:7982624-7982646 TGTCAGGGAAAAAGAAATGCTGG - Intergenic
1186794649 X:13032850-13032872 TGTCAGGGAAAAAGAAATGCTGG + Intergenic
1187058363 X:15762334-15762356 TGTCAGAGTAAACCAGAGGCAGG + Intronic
1187300739 X:18047100-18047122 TGTGAGAGTAAAACAAATGCTGG - Intergenic
1187640854 X:21287745-21287767 TGTCAGAAAATAACAGATGCTGG - Intergenic
1188469107 X:30517281-30517303 GTTAAGACTAAAACACATGCAGG - Intergenic
1189233264 X:39468885-39468907 TGTCAGAGGACAACACATCCGGG + Intergenic
1190525314 X:51323725-51323747 TGTGAGTGTAAAACACCTCCTGG + Intergenic
1190544208 X:51508202-51508224 TGTGAGTGTAAAACACCTCCCGG - Intergenic
1191912003 X:66161248-66161270 TGACAGAGTTTAACACATGAAGG + Intergenic
1192886655 X:75342424-75342446 TATCAGAATATAACAGATGCTGG - Intergenic
1193110289 X:77722679-77722701 AGTCAGGGAACAACACATGCTGG + Intronic
1193359667 X:80565959-80565981 TGTCAAAGAATAACAGATGCTGG - Intergenic
1193691023 X:84642692-84642714 TGTCAGAAAATAACAGATGCTGG + Intergenic
1198559935 X:137838490-137838512 TGTCAGGGAATAACAAATGCTGG + Intergenic
1198768361 X:140101790-140101812 TGTAAATGTAAAACACATACTGG - Intergenic
1199251928 X:145673575-145673597 GGTTAGAGTTAAACACATACAGG - Intergenic
1200916634 Y:8576846-8576868 TCTCACAGTAAAACACAGCCTGG - Intergenic